24 ms·
Baby is healed with first personalized gene-editing treatment
- adamredwoods 1y agoLet's be specific, they don't know if he is fully cured. They need more time to conclude efficacy.
- Cthulhu_ 1y agoWhile true, so far so good - the baby is 9 1/2 months old now, whereas they had a life expectancy of a week earlier without intervention.
- jakubmazanec 1y agohttps://archive.ph/VNYzA https://archive.ph/VNYzA
- chewbacha 1y agoGood thing RFK pushed out the official overseeing this financing and the current administration is actively defunding the organizations that produced this. Better to have more disabled or dead babies instead of science. /s
- LewisVerstappen 1y ago[flagged]
- fnordpiglet 1y agoRFK runs HHS which oversees multiple grant, research, and review organizations in the federal government. This includes the NIH, which has been gutted of experts that don’t share the political ideology of the political arm of the executive and / or aren’t willing to say untruths in service of their political agenda. The news is replete with stories of experts being purged leaving entire areas of research unstaffed; from various cancers to HIV to genetic engineering. Of course the same is true in other areas, such as NOAA, EPA, FEMA, etc that will cause more acute harm. The research harms will play out over decades.
- deleted 1y ago[deleted]
- JumpCrisscross 1y agoGenuine question: is this research not being pursued in China?
- sigzero 1y agoYes, other countries are pursuing this.
- mylons 1y agoit is.
- kccqzy 1y agoA Chinese scientist claimed that he did CRISPR on twins back in 2018. https://www.science.org/content/article/crispr-bombshell-chinese-researcher-claims-have-created-gene-edited-twins https://www.science.org/content/article/crispr-bombshell-chi... He was jailed for illegal medical practices but it seemed like he established a proper lab after serving the sentence and hopefully he is focused on less objectionable practices. https://www.npr.org/2023/06/08/1178695152/china-scientist-he-jiankui-crispr-baby-gene-editing https://www.npr.org/2023/06/08/1178695152/china-scientist-he...
- pacoWebConsult 1y agoFrom a purely utilitarian perspective, funding research like this is not an effective use of dollars at the margin. How many people could we save if an equivalent amount was put into reducing obesity, smoking, and drinking? How many people could we save if we stopped spending money we don't have to do things that the government isn't competent at allocating anyways? That's not to say the research itself is not impressive nor important, but think critically about the fact that this money doesn't exist in a vacuum.
- rco8786 1y agoGiven the admin’s propensity for cutting spending on research like this and other domestic interests while ratcheting up military spending I think that poster’s point stands.
- casey2 1y agoSomewhere between 0 and -100,000,000
- tchalla 1y agoI’m glad we don’t only think from a utilitarian perspective then.
- psychoslave 1y agoIt's not even that. Utilitarian premises still let a very broad set of perspective. A long term perspective on large humanity won't lead to same conclusion as what will be the most joy inducing experiences in the next 24h for the 1% wealthiest people in the world right now.
- benlivengood 1y agoAll those wasted dollars and time put into the discovery of the germ theory of disease instead of growing and distributing food to the invalids.
- wat10000 1y agoHow do you know it's not effective? The cost per life saved is extremely high now, but this stuff gets better over time. How much did penicillin cost to produce originally?
- dylan604 1y agoThe current administration doesn't care about kids. They only want you to not terminate a new kid from being born. That they care lots about. What happens after birth is not their concern. Also, I think when they say they want more babies, they want a specific subset of babies to increase.
- philipallstar 1y ago> The current administration doesn't care about kids. Of course they do. But untold amounts spent on very few kids could be spent elsewhere on many more. Federal budgets are a zero-sum game. > Also, I think when they say they want more babies, they want a specific subset of babies to increase. I've seen quite a few conservative commentators celebrate that the massively disproportionate levels of African-American abortion have been reduced, resulting in more African-American people being born, and zero bemoaning it. So maybe you're right.
- colechristensen 1y ago>KJ has made medical history. The baby, now 9 ½ months old, became the first patient of any age to have a custom gene-editing treatment, according to his doctors. This is _not_ the first human to be treated with a treatment under the wide umbrella of gene therapy based on their own edited genes. There probably is a more narrow first here but the technical details get lost in journalism which is a shame.
- jfarlow 1y ago"Custom" in that this therapy was designed AFTER a specific patient showed a need, and then given to _that_ patient. In most every other context a particular class of disease is known, a drug designed, and then patients sought that have that disease that matches the purpose of the drug. What's intriguing is not the 'custom' part, but the speed part (which permits it to be custom). Part of what makes CRISPR so powerful is that it can easily be 'adjusted' to work on different sequences based on a quick (DNA) string change - a day or two. Prior custom protein engineering would take minimum of months at full speed to 'adjust'. That ease of manipulating DNA strings to enable rapid turnaround is similar to the difference between old-school protein based vaccines and the mRNA based vaccines. When you're manipulating 'source code' nucleic acid sequences you can move very quickly compared to manipulating the 'compiled' protein.
- autoexec 1y agoOkay, I'll bite: Who then was the first patient of any age to have a custom gene-editing treatment?
- sigzero 1y ago[flagged]
- jfarlow 1y agoThis is an AI-generated response, and is inaccurate. That was one of the first cases of _germline_ gene editing using CRISPR - NOT "the first instance of gene editing." There have been quite a few other genetic editing tools that predate CRISPR, and there have been other edits using CRISPR that were not of the entire human's genome.
- LewisVerstappen 1y ago[flagged]
- atmosx 1y agoMy experience is quite the opposite - I'm actually thinking about subscribing to the NYT (again) or The Atlantic (despite their higher cost) purely for the quality of their writing.
- ferfumarma 1y agoWhat part of the article are you referring to?
- settsu 1y agoYou complain about oversimplification, then in the same breath complain about "random political stuff" being included. How is that not hypocritical, at best? This medical breakthrough would literally have not been possible without "politics". Get your head out of the sand. No one should be able to escape learning how their politics affects them or the society they are a part of. And if you want to enjoy the benefits of that society, then you don't get to complain about being reminded of how those benefits were achieved. Pandering to people's fragile political sensibilities is how the U.S. got to this point where millions of citizens voted against their own self-interest because they thought candidates running on anti-intellectual, anti-science platforms was worth the zero sum "win". Enjoy your weekends, eight hour workdays, clean air, and clean water—whether you like that those were all political or not!
- deleted 1y ago[deleted]
- MrZander 1y ago> To accomplish that feat, the treatment is wrapped in fatty lipid molecules to protect it from degradation in the blood on its way to the liver, where the edit will be made. Inside the lipids are instructions that command the cells to produce an enzyme that edits the gene. They also carry a molecular GPS — CRISPR — which was altered to crawl along a person’s DNA until it finds the exact DNA letter that needs to be changed. That is one of the most incredible things I have ever read.
- poyu 1y agoMade it sound like it's a computer, is it Turing complete?
- lordnacho 1y agoWouldn't it be surprising if it weren't? There's a bunch of things that are Turing complete, but they are not literally a molecular tape with machinery to read and write it.
- caycep 1y agoI think I recall reading at least some papers or at least exercises trying to draw analogies between Turing machines and ribosome/proteonsome and other type of cellular proteins, but I can't remember back to that class some 20 years ago...
- fwip 1y agoNot really. Delivering gene edits via CRISPR in this way is more like editing a text file with a single application of a regex - `s/ACTGACTGACTG/ACTGACTGAAAAAAAACTGACTG/g`.
- forgotpwagain 1y agoDetailed New England Journal of Medicine article about this case: https://www.nejm.org/doi/full/10.1056/NEJMoa2504747 https://www.nejm.org/doi/full/10.1056/NEJMoa2504747 And an Editorial piece (more technical than the NYT): https://www.nejm.org/doi/full/10.1056/NEJMe2505721 https://www.nejm.org/doi/full/10.1056/NEJMe2505721
- vessenes 1y agoNYT isn’t super specific here, but they made it sound like the disease treated is liver related. My understanding is that the liver is a good place to start with CRISPR-type gene treatments, in that the liver normally deals with anomalous shit in your bloodstream, say, like CRISPR type edits. So anywhere outside the liver is going to be significantly harder to get really broad uptake of gene edits. It’s crazy encouraging that this worked out for this kid, and I’m somewhat shocked this treatment was approved in the US - I don’t think of us as very aggressive in areas like this. But to me, really hopeful and interesting.
- scotty79 1y agoI don't think it's gonna be that hard. All cells that blood reaches were happily taking mRNA vaccine.
- derektank 1y agoI hate to break it to you, but it will be substantially more difficult to target other organ systems. The liver is uniquely easy to target with our current vectors. Right off the bat, the liver receives roughly a quarter of all cardiac output, either directly or second hand from the digestive organs. Additionally, the liver has a fenestrated endothelium which, while not completely unique in the body, uniquely allows molecules like lipid nanoparticles (LNPs) to access liver cells. Finally, the liver is the site of most lipoprotein processing, and LNPs can be designed to take advantage of the existing pathways to get the gene editing mRNA into the hepatocytes. All this is to say that if you have a genetic condition that primarily effects the liver, there's a lot more hope for treatment in the near term than for others. Good lecture on the difficulties of finding appropriate platforms for delivering gene therapies to cells for anyone interested [1] [1] https://youtu.be/6URTjoK58Yc https://youtu.be/6URTjoK58Yc
- XorNot 1y agoNo they were not. A vaccine triggers an immune response, not a functional change. mRNA vaccines are highly localized: you get a sore arm because most of it only gets taken up by muscle cells around the injection site, which spend some time producing the antigen and triggering a primary immune response (the inflammation aka the sore arm).
- morkalork 1y agoI think it was here a few years ago that I read a comment saying that sick children will be the Trojan horse for normalizing gene editing of humans, because who could say no to sick children, right? Well, guess it's here now, so how long utill the eugenics wars start?
- ninetyninenine 1y ago[flagged]
- psychoslave 1y ago[flagged]
- NoMoreNicksLeft 1y ago[flagged]
- ninetyninenine 1y agoA baby Hitler gaurantees a future with a grown up Hitler. Killing the baby eliminates that future. There could be other babies that can also grow up to be future Hitlers. So let's say 4 such babies exist. By killing one I eliminated 1/4 for futures with Grown up Hitlers that exist. This whole thread is getting flagged. Likely by an irrational parent who can't even compute natural selection, babe, and Hitler all in a single paragraph.
- mckn1ght 1y agoI think part of the problem is that “really good” and “really bad” are not universally accepted norms for any given ethical question. What you’re seeing is your own value system assumptions being checked. It’s perfectly reasonable to say that while a technology has the propensity to be used for evil, it also has positive applications and that the real benefit now outweighs the potential downside in a hypothetical future. Otherwise you will go down a rabbit hole at the bottom of which lies a future where we all just kinda dig in the dirt with our hands until we die because every technological innovation can be used in a variety of ways. Like, it’s silly to me that I can’t bring a 1.5” blade keychain utility knife on a flight, and then they hand me a metal butter knife in first class. I could do way more damage with that. But they allow the butter knife because the utility has shown to far outweigh the potential downside that hasn’t manifested. > I will slaughter a baby if I know for a fact that baby will grow up to be the next Hitler This is one of those things that is easy to say precisely due to the impossibility of it ever actually becoming a real decision you have to make.
- ecshafer 1y agoAs a father, the idea of being told my 1 week old baby is going to die would be my worst nightmare. The fact these doctors and scientists saved this childs life is a monument to modern medical science. This is absolutely insane. Hopefully the child doesnt need a liver transplant, but this is a great leap forward.
- javiramos 1y agoResearch funded by the NIH which our government is actively gutting
- jmcgough 1y agoYep, this effort is the culmination of 50 years of research. Could be the last harrah of the NIH with the amount of cuts we've had and the scientists who are taking jobs in other countries.
- declan_roberts 1y agoUnfortunately a staggering amount of research in other countries is largely funded by the NIH/USA.
- thrance 1y agoHow so?
- jordanpg 1y agoAnd so what?
- lenerdenator 1y agoThat means that it's not going to happen anymore. Unless those other countries step up and fund it themselves. They might. They might not.
- mmooss 1y agoIndeed - does it matter who performed the research? If the CRISPR reasearch were performed in another country, would that change the outcome for the infant?
- lentil_soup 1y agoIt was indeed researched by a combination of countries and institutions
- deleted 1y ago[deleted]
- deleted 1y ago[deleted]
- throw7 1y agoGattaca here we come!
- GenshoTikamura 1y agoOne can not simply raise valid concerns about gene editing technologies in the hands of the entities that don't hesitate sending people en masse to kill and die and otherwise manifest their fascist cravings in the open, here on HN and walk away undownvoted
- kubb 1y agoScience fiction pattern matching is a problem nobody talks about. People see something that vaguely resembles a movie that they saw and act like that movie is reality now.
- GenshoTikamura 1y agoAnother problem nobody talks about is the cognitive dissonance of living in the world today but dismissing all matching patterns as science fiction or conspiracy theories. Maybe narrow focus and short attention span are to blame
- kubb 1y agoWhen someone tells you they know how the future plays out because they saw it in fiction, oh boy you better be skeptical.
- goda90 1y agoMaybe they are actually saying "we should take steps to avoid possible futures that we've already established would be bad in our works of art". You can't just hand wave away the idea that some technology could allow for greater invasion of privacy and worse social stratification when we still live in a world where invasion of privacy and social stratification actively occur.
- Traubenfuchs 1y agoAre the edited genes inherited, or the original ones? Does the previous question have an answer that depends on the babies sex? From an evolutionary perspective it‘s interesting how the further medicine gets, the more we inherit genes unfit for life without medical support.
- breakyerself 1y agoI'm sure we'll be editing these diseases out of the germ line at the same time in the not too distant future.
- EvanAnderson 1y agoSpeaking as a person whose friend died at 21 from complications related to cystic fibrosis I would like to see these diseases edited out of the germ line.
- Balgair 1y agoNo, it's only in the liver, from what I can tell from the science, not the gametes. No, it would not depend on the sex of the baby, as the chromosomes that you're editing aren't X or Y. Evolutionarily, the inheritance of genes is a far slower process than the medical advancements we make, so what I think we're seeing here is a chasing down of the low probability events. In that, most of the evolutionary pressure is coming from things like dirty water and bad food, but as we're solving those low hanging fruit, we have to go to lower probability events to make progress that feels equally important. Also, if I am wrong here on the answers to the questions, please correct me!
- dekhn 1y agoIf they could get complete delivery to the liver stem cells, then the change could be permanent, although this is making many simplifications. Organs in your body usually keep some very old cells (formed in the embryo) around which act as parents for all the new cells in an organ. Any cell can only divide a limited number of times, so they typically maintain a "tree structure" where the old cells create children and grandchildren (etc) that then differentiate into the organ-specific cells that do the actual organ work. If you modify only the differentiated cells, eventually they die, and are replaced by descendents of stem cells; if those stem cells didn't get modified, their descendents will not have the fix, and the treatment efficacy reduces over time.
- thijson 1y ago[flagged]
- Sammi 1y agoDelete your comment. You're minimising the death of children. Yeah I'm sensitive about this. I like many other parents of children who have been lost to genetic disease have good reason to be.
- mattcantstop 1y agoWe can pause and acknowledge that life (and what that means) will change, while also acknowledging that for many it will be the easiest decision in the world for it to change.
- deleted 1y ago[deleted]
- thijson 1y agoI think it's a tool that can be used for great good. But also can be used for eugenics. That's why I pasted the link. It's a slippery slope. What a parent will do for their kids knows no bound.
- pizzathyme 1y agoIn real life, anyone who is a parent knows you would welcome a better chance for your child without hesitation
- deleted 1y ago[deleted]
- tomhow 1y agoWe detached this comment from https://news.ycombinator.com/item?id=43998721 https://news.ycombinator.com/item?id=43998721 and marked it off topic.
- bilekas 1y ago> But KJ’s treatment — which built on decades of federally funded research — offers a new path for companies to develop personalized treatments without going through years of expensive development and testing. Really incredible story and I'd love to know the process for receiving this, for example FDA approval etc. It's nice to see such in-your-face results from Federal funding programs. Without being political, it's sometimes hard for regular people to appreciate just how much good actually comes out of Federal Funding. There was another thread where someone even said something along the lines of : "Well during war things get done faster" . This simply isn't true. It might be done louder but Federal Funding never stopped pushing things forward.
- baxtr 1y agoNow imagine DOGE team of experts cutting this a couple of years ago
- bilekas 1y agoI didn't want to bring up specifics but I'd be lying if it wasn't on my mind.
- shadowgovt 1y agoIt would probably be good if more of us brought up specifics more often.
- bilekas 1y agoIt would be nice, but you know how politics can usually turn into a bit of a toxic environment online. That said, I personally don't see the DOGE thing as anything other than a way to reduce the power of regulatory enforcement. I'm sure someone who would want that would never be conflicted with interests there...
- munificent 1y agoI mean, the article is explicitly written to put it on your mind: "The implications of the treatment go far beyond treating KJ, said Dr. Peter Marks, who was the Food and Drug Administration official overseeing gene-therapy regulation until he recently resigned over disagreements with Robert F. Kennedy Jr., the secretary of health and human services." "But KJ’s treatment — which built on decades of federally funded research" "The result “is a triumph for the American peoples’ investment in biomedical research,” Dr. Urnov said." "The researchers emphasized the role government funding played in the development." "The work, they said, began decades ago with federal funding for basic research on bacterial immune systems. That led eventually, with more federal support, to the discovery of CRISPR. Federal investment in sequencing the human genome made it possible to identify KJ’s mutation. U.S. funding supported Dr. Liu’s lab and its editing discovery. A federal program to study gene editing supported Dr. Musunuru’s research. Going along in parallel was federally funded work that led to an understanding of KJ’s disease." "“I don’t think this could have happened in any country other than the U.S.,” Dr. Urnov said." This is an article about federal funding of medical research with a cute baby as the human interest bit.
- efilife 1y ago[flagged]
- frankfrank13 1y ago[flagged]
- foxglacier 1y agoIf you're being pedantic, babies usually never die - they transform into an adult which is the form that dies.
- blacksmith_tb 1y agoTypically yes? But surviving infancy is the first step on the road to immortality (but that will require more than CRISPR... probably?)
- 331c8c71 1y agoImmortality? (rolleyes)
- bigs 1y agoHopefully after living a long and fulfilling life? Geez
- morepedantic 1y agoEdgy! No one has ever considered the mortality of their children ever, or contemplated the difference between death before and after the realization of potential. Wow!
- efilife 1y agoGenuinely don't know why this is edgy. I was trying to understand his logic
- cluse 1y agoHaving a child predecease you is one of the worst things that can happen to a person in general. This is a common sentiment in humans. The strange thing is that you mentioned you're trying to follow "logic." This is not logic. These are emotions.
- foxglacier 1y agoI wonder if this also affects germline cells so he won't pass the same disease on to his children. If it does, that would be a complete departure from almost all medical treatments we use because most of them are just compensating for the effects of bad genes and leaving them in the gene pool to degrade the health of future generations.
- ufmace 1y agoDid you mean to post the same link for both?
- codeulike 1y agoIts not the same
- thomasjudge 1y agoCan you imagine the emotional rollercoaster of this for the parents
- alexashka 1y ago[flagged]
- silver_silver 1y agoWhat an insanely callous and shallow take. I don’t even know where to start. You’re trying to claim the moral high ground by complaining that a privileged child didn’t suffer and die? Do you even understand the point of reducing poverty?
- gr_norm 1y agoAn absolutely terrible and tone-deaf way to phrase that thought, but the fact of the matter is that most of the world (you and I included, in all likelihood) will not get access to this sort of thing in our lifetimes. Not because modern medicine won't have been there yet, but because our lives (and those of our children) are simply seen as being worth significantly less than a rich person's desire to become richer. How many people can even afford to get multiple opinions for a weird lump on their back? Or go to the dentist for a strange toothache? How many people can afford to get consistent exercise and eat healthy? How many lives would be saved or at least massively bettered? We already have the means to extend the life expectancy of the average person, and it's not being used. Obviously this is a wonderful medical advance, but it's depressing to wonder who it's for.
- piloto_ciego 1y agoSo obviously we should not be excited about it? Lose me with that noise.
- gr_norm 1y agoDo point out where that was said, and I will be happy to correct it! It's important to have nuanced opinions and discussions about things.
- squigz 1y ago> An absolutely terrible and tone-deaf way to phrase that thought, but the fact of the matter is that most of the world (you and I included, in all likelihood) will not get access to this sort of thing in our lifetimes. Not because modern medicine won't have been there yet, but because our lives (and those of our children) are simply seen as being worth significantly less than a rich person's desire to become richer. I'm as negative about the rich and powerful as anyone but this is such a cynical take - that might have been applied to many medical treatments in the past that have become relatively commonplace and easily accessible to people of all classes, at least in sane countries with sane healthcare systems.
- danielodievich 1y agoWhen my second son was born and was just so very tiny some genetic test came out questionable. We were very strongly encouraged to go to Childrens hospital ASAP to get more tests. He handled it well, being just a few weeks old. The tests came with "he's a carrier of something obscure but nothing to worry about", so it's all forgotten. Three interesting thing come out of it from me. First, I was on Microsoft insurance which was quite gold plated at a time, a blessing only obvious in rear-view mirror, because Childrens was quite excited to continue any number of tests. Second, the technology of all this is absolutely amazing and I am so happy that it was available to me, and it has likely gotten better. Three, I want that tech to continue to expand and current destruction up there is going to hand this torch to someone else, which makes me sad.
- jjcm 1y ago> I was on Microsoft insurance which was quite gold plated at a time One of the biggest perks of working for Microsoft for a long time was their health coverage. I can't tell you the number of times I'd be doing initial paperwork for a doctor's appointment and the receptionist would be like, "Oh you have THAT insurance, we're going to do all of the tests." I've heard they since cut back on it a little, but it truly was gold plated.
- burnt-resistor 1y agoCirca 2005, Stanford FTEs had nine (9) health insurance plan choices. ;P
- dmurray 1y agoIs that better or worse than having one really good one?
- burnt-resistor 1y ago;) Paradox of choice potentially, but allowed choosing something other than Kaiser Permanente (HMO with own facilities and doctors) such as a PPO option. What America really needs is an NHS not tied to employment or exploited by fraudsters delivering worse care for profit. Human rights shouldn't be perks of employment.
- tuna-piano 1y agoIf someone in the year 2050 was to pick out the most important news article from 2025, I won't be surprised if they choose this one. For those who don't understand this stuff - we are now capable of editing some of a body's DNA in ways that predictably change their attributes. The baby's liver now has different (and better) DNA than the rest of its body. We still are struggling in most cases with how to deliver the DNA update instructions into the body. But given the pace of change in this space, I expect massive improvements with this update process over time. Combined with AI to better understand the genome, this is going to be a crazy century. Further reading on related topics: https://www.lesswrong.com/posts/JEhW3HDMKzekDShva/significantly-enhancing-adult-intelligence-with-gene-editing https://www.lesswrong.com/posts/JEhW3HDMKzekDShva/significan... https://www.lesswrong.com/posts/DfrSZaf3JC8vJdbZL/how-to-make-superbabies https://www.lesswrong.com/posts/DfrSZaf3JC8vJdbZL/how-to-mak... https://www.lesswrong.com/posts/yT22RcWrxZcXyGjsA/how-to-have-polygenically-screened-children https://www.lesswrong.com/posts/yT22RcWrxZcXyGjsA/how-to-hav...
- bglazer 1y agoThe “How to make superbabies” article demonstrates a couple of fundamental misunderstandings about genetics that make me think the authors don’t know what they’re talking about at a basic level. Zero mention of linkage disequilibrium. Zero mention of epistasis. Unquestioned assumptions of linear genotype-phenotype relationships for IQ. Seriously, the projections in their graphs into “danger zone” made me laugh out loud. This is elementary stuff that theyre missing but the entire essay is so shot through with hubris that I don’t think they’re capable of recognizing that.
- beeflet 1y agothe road to hell is paved with good intentions. In our lifetimes we will see a brave new world controlled through eugenics.
- TechDebtDevin 1y agoYou call it eugenics, I call it biohacking ;)
- Sabinus 1y agoGene editing is not eugenics. Eugenics are managed human breeding programs. Gene editing is gene editing. In fact, gene editing completely removes the need for eugenics programs.
- VerminOctopus1 1y agoThe wealthy are already engaged in eugenics via IVF embryo selection. There are several American startups whose clientele are mainly rich SV types that want to optimize the genetics of their children.
- hooverd 1y agoI feel bad for those kids. Imagine having an issue that wasn't caught and your parents now see you as defective goods.
- burnt-resistor 1y agoHmm, I thought clinical gene editing (gene therapy) was frowned upon because it's inherently risky and fraught with ethical hazards. What technically and ethically has changed since 2005 beyond CRISPR?
- bglazer 1y agoGermline gene editing is still considered risky and unethical. That is, editing cells that form eggs and sperm, thus changing the genome of some of the descendants of the edited person. This is somatic editing. These edits will not be inherited. Somatic editing is becoming more common (see Casgevy) but there are technical hurdles that prevent its application to many cases.
- zharknado 1y ago> This is somatic editing. These edits will not be inherited. Genuine question- how do we know that? Is it just that the edits are very improbable to accumulate in the gonads in sufficient quantities to persist? We can’t actually prevent some fraction of them from reaching other parts of the body, right?
- burnt-resistor 1y agoI'd like to know that too. When a gene therapy is administered to a person after birth, what % of cells get the edit and with what approach(es)? Doesn't that also edit oocytes and spermatocytes too?
- pawanjswal 1y agoIncredible to see science and love come together to rewrite a baby’s future.
- karunamurti 1y agoI thought the first gene edited babies were from He Jiankui
- lemonberry 1y agoI know nothing of this area, but it seems to me this could make cloning easier, right?
- valunord 1y ago[flagged]
- bglazer 1y agoNo, it’s not what you describe. Also it seems like you think the mRNA vaccines were harmful. Can you briefly describe what mRNA is and how the mRNA vaccines would have harmed this child?
- dralley 1y agoMaybe try reading the article? TL;DR No, the baby had a rare and otherwise inevitably fatal genetic condition.
- aussieguy1234 1y agoWhat does this mean for longevity research? Could the same treatment potentially be adapted to make edits that could lengthen lifespan of healthy people?
- claudeomusic 1y agoDamn what a strange time to be alive. Juxtaposing this against the constant nonsense coming from RFK is as jarring as it gets.
- deleted 1y ago[deleted]
- zephyreon 1y agoThis is incredible. Probably the most exciting piece of news I’ve read in years.
- kouru225 1y agoPandora’s box just opened Again
- nothrowaways 1y agoWe done to Musunuru an amazing cardiologist.
- ddudas 1y agoI am sure this article would have been mentioned in Homo Deus
- Brystephor 1y agoThis is incredible work. Its jaw dropping to learn that something like this is possible at all. Sometimes I wish I could work for a company whose products make a meaningful positive contribution to the work. Do companies like this have a need for SWEs? Are there opportunities for a backend SWE without any background in hardware or biology?
- globular-toast 1y ago> Do companies like this have a need for SWEs? Are there opportunities for a backend SWE without any background in hardware or biology? Of course they do. Biology and medical research can't get enough software people. But they're not as well funded as advertising or spying companies, for example, so you might have to take a significant pay cut. I wouldn't pigeon hole yourself as a "backend engineer". Why do people do that? Software is software. The bit that matters is the core model and algorithms etc. Whether it's exposed as a web server, a CLI or just a library is a peripheral detail. It's totally possible for a decent software engineer to learn just enough biology to get by. The limiting factor might be your interest, though. But if you have that then go for it. Get a book on genomics right now.
- rubidium 1y agoYes. Aldevron and IDT are two companies (owned by danaher) that collaborated to make this happen. They have multiple authors listed in the NEJM article. https://jobs.danaher.com/global/en/search-results?keywords=Software https://jobs.danaher.com/global/en/search-results?keywords=S...
- waiquoo 1y agoMark Behlke's group at IDT is the force behind a LOT of the development of CRISPR, but they are relatively unknown
- armedgorilla 1y agoI run a small software team at a small biotech working on diseases with small patient populations, and the answer is yes x 1000. The issue is that in drug companies, software isn't the product, so SWEs will never make as much money nor be as much of a priority as in tech-proper. There are two categories of software we need help with: 1. Salesforce for science. We don't have big data in terms of volume; we have big data in terms of heterogeneity. Tons of small data sets that need context to be interpreted, including measuring uncertainty. This software, often called an eLN or LIMS, is offered by expensive vendors who each have their custom, locked-in implementations. Every organization needs customization on top of this that can be developed and change with the changing direction of the bench scientists. 2. Informatics tools. Much of the heavier computational tools (bioinformatics, molecular dynamics, stats) were developed by academic labs, who don't have the training or incentives to create sustainable software. Alternatively, they are made by vendors who write software on short-term contracts, so they don't have expertise in house. Our mass spec vendor told us to put their analysis servers on our Citrix so employees could access it. Citrix! If you can convince those vendor to hire you and rewrite their software, please do. Despite cool tools like alphafold making headlines, the software needs in drug development are more mundane. We need people who are excited to sit down with bench scientists and help them figure out how very normal tools can be applied to their work.
- carabiner 1y agoCould this be used to heal adults with the same genetic disorder?
- palisade 1y agoDoes this mean when they grow up, their own offspring will also have this defect and require a correction? And, if so, does this mean it is now introducing this defective gene into our gene pool? I know this is an issue with caesarean section. It is becoming more prevalent because those who require it are surviving, making it more likely to happen in their offspring.
- mondaygreens 1y agoHow can they pass it on when they don't have the defect any more?
- raldi 1y agoThe DNA was only edited in the liver. But by the time this baby grows up and starts a family, we'll probably be able to fix that, too.
- aucisson_masque 1y agoThat's a bold claim. The baby is 9 month old, there are many things that can still go wrong with this experimental treatment. Hopefully not, but even then no one can say what progress will make science in the next 25 years. Back in the 50's people thought we would be driving in flying car in 2000.
- raldi 1y agoFour years ago highly-upvoted /r/SanFrancisco comments said self-driving taxis were decades away: https://old.reddit.com/r/sanfrancisco/comments/nbjsij/real_robotaxi_service_gets_a_step_closer_in_san/gy0noso/?context=3 https://old.reddit.com/r/sanfrancisco/comments/nbjsij/real_r...
- aucisson_masque 1y ago12 upvotes... You can't compare that to gene-editing treatments, that's two completely different level. Self driving car were always almost feasible, 20 years ago top gear made cars you could drive with controller like kids do with toy cars. We already had camera and computer, it was just a matter of raw CPU performance and software development..
- kjkjadksj 1y agoHonestly the biggest barriers to a lot of advancement right now in biology from medicine to our food supply depend squarely on getting uneducated people over their aversions to modern science. It is crazy. We are really at the “I don’t trust that locomotive/airplane/car” stage where what the public understands about the field is so far away from the state of the art and the risk considerations that have been put in place by the actual domain experts who have thought of all your concerns already. It isn’t just lay people either but government officials in charge or permitting and approvals that need the most convincing. They might be out of the field themselves for a decade or more.
- WorldPeas 1y agoThe problem is there is so little optimistic futurist media, the number of optimistic movies I've seen about the future I can count on my left hand. I can't square the blame entirely on Hollywood, but it's a shame there is so little discussed about the American state-of-the-art, something I believe China does better is center technological development in discourse, I see very little talk of the modern miracles we've witnessed outside of HN
- stogot 1y agoI can’t read the full article, but I’m wondering how they got FDA approval for a one-off personalized treatment here outside a trial? Aren’t people dying because they were waiting for FDA approval for other experimental treatments?
- sirobg 1y agoDid AI help at any step in the process?
- codeulike 1y agoHere's the actual paper https://www.nejm.org/doi/full/10.1056/NEJMoa2504747 https://www.nejm.org/doi/full/10.1056/NEJMoa2504747 This site has a much better write up than the NYT: https://innovativegenomics.org/news/first-patient-treated-with-on-demand-crispr-therapy/ https://innovativegenomics.org/news/first-patient-treated-wi... Under normal circumstances, developing and testing a new CRISPR therapy takes years, but this patient — and others born every day with severe genetic disorders — do not have years to wait. Getting all of the pieces together for this emergency need took rapid coordination amongst teams at multiple academic and for-profit organizations, only possible because of both years of preparation and some lucky connections. ... Prior to receiving the CRISPR therapy, KJ’s prognosis was poor, but there were several factors that made KJ’s case a good candidate for a rapid CRISPR intervention. An ongoing research study at the IGI called INGENUITI enabled the team to immediately enroll KJ and his parents for genome sequencing and analysis. The mutation in KJ’s genome was a single base — just a one-letter change in his genetic code — and one that could be corrected using base editing, a gene-editing technique that only makes a single-letter edit. Additionally, the researchers needed to edit cells in the liver, where the faulty protein is made. The liver is currently one of the organs in the body that can be targeted for in vivo gene-editing therapies using lipid nanoparticles. ... One of the first steps involved characterizing the mutation in KJ’s genome and designing the guide RNAs that allow the base editor to precisely target a specific letter in the patient’s genome for repair. Kiran Musunuru’s team at Penn accomplished that in record time. Next, the team at the IGI jumped in to do the necessary safety assessment work so that the FDA could assess the risks.
- deadbabe 1y agoDo you think someday soon we will have the equivalent of an LLM coding assistant, but for gene editing?
- Cthulhu_ 1y agoDefinitely not soon, there's a lot of conditions at the moment for this to be applicable (from what I gather, I'm no expert, just a HN commenter), and well before wholesale gene editing is a thing there will be the legal aspect. I mean the precursor to gene editing is selective breeding, which on humans quickly leads to eugenics.
- deadbabe 1y agoDon’t know why so much fear over eugenics. You either resign to waiting millions of years for evolution to do its thing, or we just take matters into our own hands at some point and evolve faster.
- deleted 1y ago[deleted]
- xrhobo 1y agoI love LLMs but that sounds like one of the worst ideas I can even think of.
- sas224dbm 1y agoA Gattaca moment ?
- poopsmithe 1y agoThank you scientists! Next, pretty please figure out how to grow ironmouse a new immune system! <3
- MoralIThink 1y ago[flagged]
- otikik 1y agoThat is great news and my congratulations to the parents. Hopefully it's something that we can repeat many times in the future.
- voidUpdate 1y agoCould this be used to actually change the DNA of transgender people?
- albrewer 1y agoEven if it did, wouldn't the development of the wrong genitials for their preferred sex make an edit like this meaningless? The existence of XX AMAB and XY AFAB people goes to show that it's more about what happens in utero than what genes you have after birth.
- idontwantthis 1y agoThat’s an entire chromosome throughout every cell in the body. This is a single gene change in one type of cell. No.
- MoralIThink 1y ago[flagged]
- zoklet-enjoyer 1y agoMy girlfriend and a couple friends work at one of the companies that developed this and they're quite excited and proud of it and I of them.
- MoralIThink 1y ago[flagged]
- ckemere 1y agoThe work outlined in the actual paper is quite remarkable. Within this 6 month period they generated transgenic mice with the precise mutations (paternal and maternal) this baby had in order to test treatment for functionality and toxicity as well as a doing a toxicity study in monkeys. To those thinking about commercialization opportunities, these two steps seem the most labor intensive and time consuming, but also the most necessary in order to actually have confidence to inject completely customized gene editing therapy in a kid. (Also worth highlighting for folks opposed to animal research.)
- jacktheturtle 1y agowe progress closer and closer to a "red rising" type future -- exciting and scary. exciting for the family and child <3
- thesparks 1y agoMy daughter has a genetic condition (PKU) that is also caused by a single letter change in her DNA and also causes brain damage if she consumes too much protein. Luckily it can be controlled with a strict low-protein diet (<10 grams a day). This is SO exciting! The fact that there is a chance of a cure has absolutely made my day!
- Lichtso 1y agoNot to downplay what a huge achievement this is and how far the field of medicine has come, but ... this still leaves a slight bitter taste in my mouth: If they edit specific genes one way they can also do the opposite direction. And if I understand correctly, they did with a bunch of lab rats? Now, this and similar stuff have obviously been discussed before, essentially "12 Monkeys": Somebody releasing some runaway gene-editing mechanism, be it a virus or what not, and using it as means to mass destruction. However, that is not even what I worry about because that is nothing new, viruses have existed longer than most other kinds of life on this planet. Instead, what just popped into my mind is more like ransomware but on your body cells. Attacker edits victims genes to some condition that is lethal within a week or so and then blackmails them in order to edit it back. Kinda like the "Carrying the Antidote"-trope, only that there is no other cure in time. Maybe worth a Black Mirror episode ... anyway you heard / read it here first ;) edit: To the people downvoting, why not engage in the conversation instead? I am not saying we shouldn't be doing this, just that this is a fun crime scenario in a movie. What is wrong with that?
- skeaker 1y agoIf you wanted to do that you could just release a cancer-causing agent and it would similar mess with their DNA and kill them much more effectively at a fraction of the cost. Or just blow them up or something. Harming the masses in such a roundabout way won't leave the realm of science fiction because it is so much less effective and so much more difficult to do than existing methods. Not worth worrying about even in theory.
- Lichtso 1y agoRight, yet you did not read my post: > However, that is not even what I worry about because that is nothing new, viruses have existed longer than most other kinds of life on this planet.
- deleted 1y ago[deleted]
- treszkai 1y agoI love how the last lines of the article read, > “I don’t think this could have happened in any country other than the U.S.,” Dr. Urnov said. > “We all said to each other, ‘This is the most significant thing we have ever done.’” And then in the Discover More section is this article: > Lab Animals Face Being Euthanized as Trump Cuts Research
- opyate 1y agoI prefer the Perplexity summary over the nytimes' style of weaving facts with narrative: https://www.perplexity.ai/page/baby-born-with-life-threatenin-e5KwBFrvSAyjIObfQyzolA https://www.perplexity.ai/page/baby-born-with-life-threateni...
- ColonelPanek 1y agoNot quite. The child still has the disease and will need lifelong treatment for not only the disease itself, but also the gene editing procedure. This procedure costing upwards of $800,000 simply trades one disease process for another. It would be interesting to find out if this child does indeed end up getting the liver transplant that was sidelined for this new one off procedure.
- Sharon886 1y ago[dead]
- Slava_Propanei 1y ago[dead]