12 ms·
> To accomplish that feat, the treatment is wrapped in fatty lipid molecules to protect it from degradation in the blood on its way to the liver, where the edit
by MrZander 1y ago
> To accomplish that feat, the treatment is wrapped in fatty lipid molecules to protect it from degradation in the blood on its way to the liver, where the edit will be made. Inside the lipids are instructions that command the cells to produce an enzyme that edits the gene. They also carry a molecular GPS — CRISPR — which was altered to crawl along a person’s DNA until it finds the exact DNA letter that needs to be changed.
That is one of the most incredible things I have ever read.
- poyu 1y agoMade it sound like it's a computer, is it Turing complete?
- lordnacho 1y agoWouldn't it be surprising if it weren't? There's a bunch of things that are Turing complete, but they are not literally a molecular tape with machinery to read and write it.
- caycep 1y agoI think I recall reading at least some papers or at least exercises trying to draw analogies between Turing machines and ribosome/proteonsome and other type of cellular proteins, but I can't remember back to that class some 20 years ago...
- fwip 1y agoNot really. Delivering gene edits via CRISPR in this way is more like editing a text file with a single application of a regex - `s/ACTGACTGACTG/ACTGACTGAAAAAAAACTGACTG/g`.
- anthk 1y agoSo, Perl or sed. If it's Perl, the guy from XKCD was right. And, maybe, Larry Wall.
- xarope 1y agoTIL my years of perl regex'ing was preparing me for a future of DNA gene warfare (core war, anybody?)
- duskwuff 1y agoI don't know if it still is, but, for a while, Perl was actually fairly popular in bioinformatics: https://bioperl.org/ https://bioperl.org/
- koeng 1y agoIt's fundamentally different than a computer and arguably more complete. The talk of "crawling along the genome" is kinda fundamentally wrong though and is a bit irking - CRISPR kinda just bumps around until it hits a PAM site, in which case it starts checking against sgRNA. Much more random than they make it seem
- anthk 1y agoThis is crazier: https://www.sciencealert.com/are-we-all-quantum-computers-with-quantum-brains https://www.sciencealert.com/are-we-all-quantum-computers-wi... About CRISP, it's like the ultimate Perl+Regex for the body.
- drjasonharrison 1y ago"Bumps around until it hits" sounds like a set of magnets arranged to only mate up in a specific direction. Except we have four nucleotides rather than only two magnetic poles.
- Robotbeat 1y agoYeah, in some ways, the genetic code and molecular biology around transcription, etc, more closely resembles the abstract Turing Machine than an actual computer does. Absolutely fascinating that the messy world of biology ends up being pretty analogous to the clean world of binary logic. Gene sizes are expressed in kilobases, where a base carries 2 bits of information.
- davedx 1y agoSounds kind of like the infinite tape machine....
- mr_toad 1y agoAbout 6 billion letters in human DNA.
- buzzy_hacker 1y agoMade me think of It was only in college, when I read Douglas Hofstadter’s Gödel, Escher, Bach, that I came to understand cells as recursively self-modifying programs. The language alone was evocative. It suggested that the embryo—DNA making RNA, RNA making protein, protein regulating the transcription of DNA into RNA—was like a small Lisp program, with macros begetting macros begetting macros, the source code containing within it all of the instructions required for life on Earth. Could anything more interesting be imagined? Someone should have said this to me: > Imagine a flashy spaceship lands in your backyard. The door opens and you are invited to investigate everything to see what you can learn. The technology is clearly millions of years beyond what we can make. > > This is biology. –Bert Hubert, “Our Amazing Immune System” from https://jsomers.net/i-should-have-loved-biology/ https://jsomers.net/i-should-have-loved-biology/
- dekhn 1y agoThis system isn't really turing complete, but existing biology provides everything required to make a computer which is Turing complete (assuming non-infinite tape size). True programmatic biology is still very underdeveloped. I have seen logic gates, memory, and state machines all implemented, but I don't think anybody has built somethign with a straightforward instruction set, program counter, addressable RAM, and registers that was useful enough to justify advanced research.
- joshmarlow 1y agoIf this thread interests you, you should check out "Blood Music" by Greg Bear. It's pretty old but the premise is that a researcher 'closes the loop' in a bunch of cells by making them able to edit their own DNA - thus making them Turing Complete. Hilarity subsequently ensues.
- dekhn 1y agoCells are already able to edit their own DNA. Examples include the yeast mating switch, in which the "active" gene is replaced by one of two templates, determining the role the yeast plays in mating (https://en.wikipedia.org/wiki/Mating_of_yeast#Mechanics_of_the_mating_type_switch https://en.wikipedia.org/wiki/Mating_of_yeast#Mechanics_of_t...) Further, your immune system does some clever combinatorial swapping to achieve diversity (https://en.wikipedia.org/wiki/V(D)J_recombination https://en.wikipedia.org/wiki/V(D)J_recombination). The generated diversity is then screened by the immune system to find highly effective antibodies that bind to specific foreign invaders. Doing something actually interesting from an engineering perspective makes for fun science fiction, but as always, the specific details in that story would be a very unlikely outcome.
- xarope 1y agoAs I get older, I'd be happy with some minor incremental progress on addressing myopia and hyperopia.
- Balgair 1y agoOne other fun part of gene editing in vivo is that we don't actually use GACU (T in DNA). It turns out that if you use Pseudouridine (Ψ) instead of uridine (U) then the body's immune system doesn't nearly alarm as much, as it doesn't really see that mRNA as quite so dangerous. But, the RNA -> Protein equipment will just make protiens it without any problems. Which, yeah, that's a miraculous discovery. And it was well worth the 2023 Nobel in Medicine. Like, the whole system for gene editing in vivo that we've developed is just crazy little discovery after crazy little discovery. It's all sooooo freakin' cool. https://en.wikipedia.org/wiki/Pseudouridine https://en.wikipedia.org/wiki/Pseudouridine
- Teever 1y agoI suppose a downside (depending on your perspective) of this is that it will make people who are genetically modified in this fashion trivial to detect. That's good if your goals are to detect genetic modification which may be considered cheating in competitive sports. That's bad if your goals are to detect genetically modified people and discriminate against them. I see a near future where the kind of people who loathe things like vaccines and genuinely believe that vaccines can spread illness to the non-vaccinated feel the same way about other things like genetic modification and use legal mechanisms to discriminate and persecute people who are genetically modified.
- ale42 1y ago> it will make people who are genetically modified in this fashion trivial to detect. I'm not totally sure. If I understand it correctly, the mRNA contains pseudouridine, and it makes the protein that will edit the DNA. The edited DNA should look like a normal one.
- Teever 1y agoAh. That makes sense. My mistake.
- LawrenceKerr 1y agoIf you're going to make the comparison with vaccines, and if history is any indication, the more realistic worry would be the other way around (since that's where the money is): that genetic modifications will be mandated, and that those who object will be discriminated against. [And no, I am not anti-vax, nor anti-gene-editing.]
- shadowgovt 1y agoGene therapies are pretty incredible. Some of them are still making a button-hole with a machete, but that's relative to the previous medical intervention of a button-hole with a tank's main gun. One of the treatments for sickle-cell involves switching off the gene that makes the malfunctioning red blood cells, but of course that's not sufficient; you'd stop making red blood cells completely and you'd die. So it's combined with a modification that switches on a gene that all humans express pre-birth that causes your body to make "super-blood": red blood cells with significantly more binding points for oxygen. This is necessary because a fetus gets oxygen from its mother's blood, so the increased binding affinity is useful for pulling the oxygen towards the fetus at the placental interface. After birth, expression of that gene is disabled and regular RBC genes switch on. So the therapy doesn't "fix" sickle RBCs; it disables the body's ability to make them and re-enables fetal RBCs! I have seen no literature on whether having fetal RBCs in adulthood has any benefits or drawbacks (besides changing the affinity ratio for their fetus if the patient gets pregnant, I imagine increased-affinity RBC could help for athletics... But I also imagine it requires more iron to generate them so has dietary impact).
- nomadpenguin 1y agoHigh affinity RBCs would actually be a disadvantage for athletics. You actually don't need very high affinity to pick up oxygen from the lungs -- your lungs are comparatively extremely high in oxygen. What matters more is being able to drop the oxygen off in peripheral tissues. Higher affinity means that it's harder to actually deliver the oxygen, which is why we evolutionarily developed the switch away from fetal hemoglobin.
- philsnow 1y agoI thought the evolutionary impetus for fetal hemoglobin was because it greatly increases the efficiency of fetal oxygen uptake across the placental interface? From shadowgovt: > I have seen no literature on whether having fetal RBCs in adulthood has any benefits or drawbacks (besides changing the affinity ratio for their fetus if the patient gets pregnant This was exactly the question that popped into my mind when I read about switching from normal adult RBCs to fetal RBCs: does this therapy reduce the likelihood of carrying a baby to term?
- jjtheblunt 1y ago> That is one of the most incredible things I have ever read. This is even more great reading behind the above: https://en.wikipedia.org/wiki/Jennifer_Doudna https://en.wikipedia.org/wiki/Jennifer_Doudna
- bengale 1y agoWalter Isaacson's book "The Code Breaker" is about this subject. I couldn't put it down.
- beoberha 1y agoAll his books are like that. The Innovators is my personal favorite.
- ascorbic 1y agoA rare case where the list of awards she's received is so long it needs a separate Wikipedia page https://en.wikipedia.org/wiki/List_of_awards_and_honors_received_by_Jennifer_Doudna https://en.wikipedia.org/wiki/List_of_awards_and_honors_rece...
- pavlov 1y ago[flagged]
- blangk 1y agoThis seems like a non sequitur.
- sgustard 1y agoI assign only the most nefarious motives to those clowns, but at least her govt profile is intact: https://www.lbl.gov/people/excellence/nobelists/jennifer-doudna/ https://www.lbl.gov/people/excellence/nobelists/jennifer-dou... The fact that this treatment "built on decades of federally funded research" is the scary part, given that such funding may disappear.
- fsndz 1y agoNever bet against science !
- znpy 1y agoYep, this is truly incredible!
- ac29 1y ago> To accomplish that feat, the treatment is wrapped in fatty lipid molecules to protect it from degradation in the blood on its way to the liver, where the edit will be made. Inside the lipids are instructions that command the cells to produce an enzyme that edits the gene. This isnt entirely unlike the method mRNA vaccines use. Through some clever biochemistry, mRNA vaccines get bits of code into cells where the cell's built in code compilers manufacture proteins that induce immunity. We have developed software patches for our biology.
- _heimdall 1y agoI know someone well who works in this space, personalized gene therapy as cancer treatment. > until it finds the exact DNA letter that needs to be changed. This pine is disingenuous (at best). There is no way of guaranteeing where the DNA is inserted. It is designed to only slot into a very specific portion of the DNA but they don't have a way to control that precisely, the accuracy is high but "exact DNA letter" is skipping over a few pretty important details. To be clear I'm not saying it is ineffective or unsafe, only that the claim made is marketing speak and not actually true.
- Thebroser 1y agoThe approach they used which is base editing doesn’t actually insert or remove DNA, it actually uses an enzyme to convert one base to another, which is much safer as this doesn’t require a double strand break in DNA: https://blog.addgene.org/single-base-editing-with-crispr https://blog.addgene.org/single-base-editing-with-crispr
- _heimdall 1y agoThat is interesting, I didn't catch the difference my first time through the article. I do still question their claim of 100% precise results though. At least based on that high level description I can definitely see it being safer, but I question any scientific claim that is an absolute. Specific to the editing vs insertion mechanism, I question how it doesn't run into similar constraints where the mechanics of targeting exact portions of the DNA can occasionally miss or impact the wrong segment of DNA entirely. I haven't dug as deeply down the base pair conversion though, so I could absolutely be wrong!
- yieldcrv 1y agoRunning this article through GPT and asking it more questions is one of the most incredible allocations of productivity I have ever seen
- dclowd9901 1y agoI literally said the same thing out loud. I had heard about CRISPR a while back but most reporting on it kind of hand waved over the mechanisms of how it actually accomplishes its work. What these researchers have figured out to make this work absolutely blows my mind.
- j16sdiz 1y agoAFAICT, CRISPR still make many bad edits. We relies on the fact that most of those bad edit won't survive.
- rubidium 1y agoIt can make “bad edits” eg off target effects. But in this case there were, as far as is known, none. It’s aided that this was a single nucleotide defect. They specifically tested for off target edits in the mouse study and found no harmful edits (and very rare off target ones). That plus the specific targeting of the liver cells (no germ line effect expected), makes this a low risk approach and certainly better than doing nothing.
- cryptoegorophy 1y agoHow does it know how to gps around? From what I know everything down there is a chemical reaction with some minimal physical motion, but how do you program it to know where to change and what and how.
- TheJoeMan 1y agoIt’s more like a “ctrl+F” for DNA. Hopefully there’s only 1 match (the target site).
- 0x1ceb00da 1y agoSo you create a molecule that binds to a certain location in the dna, and then deploy a billion of them?
- rubidium 1y agoMore or less, yes. An interesting part of the study was determining what a clinical dose _should_ be. You need enough to edit enough liver cells. But don’t really want to completely overdo it to limit potentially negative side effects. Seems like they got it right enough here, with the first dose having some effect and the subsequent dose having more.
- Tuna-Fish 1y agoYou need billions to cover multiple cells, you don't need many for a cell. The counterintuitive part is how fast thermal motion is relative to the size of dna. In body temperature water, the thermal velocity of water molecules jostling around everything is ~600m/s. The nucleus of a human cell is ~6µm in diameter. That is, your average water molecule bounces around at a speed that makes it move from one end of the nucleus to another roughly 100 million times per second. Larger molecules move more slowly, but they still zip around fast enough that nothing needs to "seek" to a specific position in a cell to get there, everything will touch everything just from thermal random walk in a very short time. So how biology works is that inside the cell there might be just one messenger, which will have to hit a specific piece of dna just right in order to do anything, but that's still nearly instantaneous from our perspective.
- deleted 1y ago[deleted]
- vmurthy 1y agoCue the book "The Code Breaker" [0]. I read it a long time ago and such an incredible book and journey by Jennifer Doudna and Emmanuel Charpentier. Do check it out https://en.wikipedia.org/wiki/The_Code_Breaker https://en.wikipedia.org/wiki/The_Code_Breaker
- ziofill 1y agoA chemist friend of mine did his thesis on lipid vesicles, and I remember my mind being blown when he told me these are modelled as a liquid on the 2D plane of the membrane, but as a solid on the 1D orthogonal direction because the energy to swap two lipid molecules side by side is incredibly low (because it makes barely any difference), while the energy to swap them orthogonally to the membrane is much larger (because they would point in the wrong direction).
- ajkjk 1y agoOh that's neat
- verisimi 1y agoOnce the gene has been edited, things will work. But at some point that cell will die. Why would the replacement cell also have the edit? The DNA in the rest of the body's cells will still not be correct.
- riffraff 1y agoWhen cells duplicate they have the same (altered) DNA so the mutated cells survive. You'll end up with mosaicism (cells with different DNA) but presumably you have enough of the new cells to fix the problem the original ones had. You don't need to fix all the body, you just need to fix some of the, say, liver, and you're good.
- esalman 1y agoThanks to DOGE you might read less and less about this kind of things.
- shafyy 1y agoUnfortunately, this is true. From the article: > The implications of the treatment go far beyond treating KJ, said Dr. Peter Marks, who was the Food and Drug Administration official overseeing gene-therapy regulation until he recently resigned over disagreements with Robert F. Kennedy Jr., the secretary of health and human services.
- pishpash 1y agoAlso presents a terrifying prospect of malicious use.
- DrScientist 1y agoBear in mind that they intentionally choose something that was soluble - ie the easiest thing possible. So it's doesn't mean everything is now solvable. For example it's no coincidence this is a liver disease as basically almost everything you inject in the bloodstream ends up concentrating in the liver by default - if you needed to target another organ with your LNP it would be much harder. Most of the time people are trying to stop stuff accumulating in the liver! The liver has other special properties that are helpful as well. Having said all that - it is still a massive achievement. > That is one of the most incredible things I have ever read. Biology is incredible - and you can do incredible things if you leverage it.
- abcd_f 1y ago> that was soluble solvable
- DrScientist 1y agosoluble has two meanings. - able to dissolve in solvent - able to be solved.
- jakeydus 1y agoHuh, TIL!
- abcd_f 1y agoIs the second meaning archaic?
- DrScientist 1y agoHow old does it need to be to be archaic? Here is a use in the title of a quite famous popular science book from the 1960's. https://www.routledge.com/The-Art-of-the-Soluble/Medawar/p/book/9781032116853 https://www.routledge.com/The-Art-of-the-Soluble/Medawar/p/b...
- Den_VR 1y agoYou should have seen the homebrew guy’s talk on DIY CRISPR where he injected himself on stage. And that was years ago. Incredible times for incredible work.
- harhargange 1y agoI work on lipids and i myself didn't know they could be so much practically important.