24 ms·
Moderna mRNA sequence released to GitHub [pdf]
- kart23 6y agoWhat are the purple and blue sections after the stop codon for? I read a little about the 3' region, but for the vaccine, are these sections taken from a particular natural human sequence, or specially engineered for something else?
- layoutIfNeeded 6y agoThat’s the copyright notice.
- iso1337 6y agoIt's the 3' (3-prime) UTR (un-translated region). It can affect the translation of the mRNA. https://en.wikipedia.org/wiki/Three_prime_untranslated_region#:~:text=In%20molecular%20genetics%2C%20the%20three,post%2Dtranscriptionally%20influence%20gene%20expression https://en.wikipedia.org/wiki/Three_prime_untranslated_regio.... The next thing is the poly-A tail: https://en.wikipedia.org/wiki/Polyadenylation https://en.wikipedia.org/wiki/Polyadenylation blasting the 3' UTR, we see it ~50% of it was copied from the human mitochondria tldr, extra regulatory signals (often not well understood)
- deleted 6y ago[deleted]
- dnautics 6y agoDoesn't really make sense for it to copy from the mitochondrion; I presume this thing gets expressed in the cytosol.
- fabian2k 6y agoThe 3' and 5' untranslated regions are the parts of the mRNA directly before and after the part that encodes the actual protein. So they are themselves not translated into amino acids. What they actually do can vary, but essentially they can provide places for other things to bind and influence what happens with the mRNA. There are some fancier cases like riboswitches, but you don't see those in humans. The stuff at the start and end of the mRNA also determines stability of the mRNA.
- flobosg 6y agoIn the BioNTech/Pfizer mRNA, the 3' (or the latter) half of the 3'-UTR comes from human mitochondrial 12S rRNA. The Moderna one has the 3'-UTR of the alpha subunit of human hemoglobin.
- hfjfktmtkrn 6y agoAmong other things that purple region determines the "priority"/"intensity" of the whole sequence. You want it as high as possible to make as much spike protein as possible. It's proprietary information, mostly they try various possibilities until they find one with high expression.
- Asparagirl 6y agoSo it’s the mRNA version of !important in CSS?
- hfjfktmtkrn 6y agoMore like font-weight, since !important is binary and this is more of a gradient.
- _theory_ 6y agoThat's the part that makes you randomly yell, "Hail Bill Gates!"
- VectorLock 6y agoPeople joked a lot about "injectible source code / machine code" but it is kind of interesting injecting yourself with something that has the source on github.
- vmception 6y agoWe aren’t that different from machines, we just need to know more about the CPU and all the co-processors and how the logic gates interact But for now we can inject code to trigger protein configuration via the immune system
- _joel 6y agoDoes that mean a cytokine storm is the equivalent of a buffer overflow or a DoS?
- YarickR2 6y agoIDS with ability to launch countermeasures, and no negative feedback loop
- fabian2k 6y agoA cytokine storm is when you trick the antivirus into thinking all major system files contain a virus.
- Angostura 6y agoCytokine storm would perhaps be like the user deleting random necessary OS executables in an attempt to get rid of malware
- anyfoo 6y ago> We aren’t that different from machines, we just need to know more about the CPU and all the co-processors and how the logic gates interact Except it is unfortunately not that simple, because it assumes that distinct components such as CPU, co-processors and even logic gates exist in that context, as is totally reasonable to assume on devices created by humans. Abstracting complex machines into distinct components is a proven strategy to engineer a system, but it's not a necessity for functioning systems to exist. In the case of natural organism, they "just" need to work. They don't have a blueprint, and they don't need to be organized in a way that allows for easy understanding by looking at individual parts in separation. Consider also the difference between machine learning through neural networks ("we stuff a lot of training data in there and get what we want eventually, we hardly understand what the model does or why it fails"), and a QR code reader ("we carefully designed the format from the top down, including e.g. framing, error correction, and several invariants like rotation; if a QR code does not get recognized, we can usually tell exactly where and why it failed").
- elliekelly 6y agoI’m a little confused by the title? Looking at the document, it seems to me (knowing next to nothing about this field) it includes both Pfizer and Moderna’s protein spike sequence in figures 1 and 2, respectively. Is that correct? It’s also interesting the way it’s worded: that the sequence was “assembled from $vaccine”. Does that mean whoever published this has backed into these sequences rather than having gathered this information directly from the source(s)?
- hfjfktmtkrn 6y agoThey sequenced vaccine leftover remaining in used vials. So reverse engineering basically.
- usrusr 6y agoAnd reverse engineering only sounds dramatic until you take a step back and acknowledge that it's what they literally do all the time. Only that usually the sequences they read are not the outcome of some human development effort but of naturally occurring evolutionary processes.
- flobosg 6y agoThe authors reverse engineered the sequences of the vaccines, obtaining them from the remaining mRNA present in the vials. “Assembly” in this case means that they merged several short sequences they obtained, each representing a fragment of the whole mRNA sequence.
- phcordner 6y agoYou are correct. The researchers here sequenced each vaccine starting with the bit of vaccine left in the vial after administration. The goal was to get a raw sequence of the Moderna mRNA component so it can be easily filtered out as being a signal of therapeutic origin. Pfizer's sequence has already been published; it's incldued here to confirm that the result achieved experimentally matches the published sequence.
- yrral 6y agoRelated: Here's a article from late last year describing and explaining the source code of Pfizer vaccine: https://berthub.eu/articles/posts/reverse-engineering-source-code-of-the-biontech-pfizer-vaccine/ https://berthub.eu/articles/posts/reverse-engineering-source... It's a very interesting read and I hope the author makes another post explaining the differences of the two mrna vaccines.
- throwawaysea 6y agoFrom that link: > The injection contains volatile genetic material that describes the famous SARS-CoV-2 ‘Spike’ protein. Through clever chemical means, the vaccine manages to get this genetic material into some of our cells. > These then dutifully start producing SARS-CoV-2 Spike proteins in large enough quantities that our immune system springs into action. Confronted with Spike proteins, and (importantly) tell-tale signs that cells have been taken over, our immune system develops a powerful response against multiple aspects of the Spike protein AND the production process. What happens to the "volatile genetic material" at the end of this? Does it just linger in the body indefinitely? Or does it somehow get destroyed (and what does that mean)? From my reading of the above excerpt, it's the produced spike proteins that get destroyed but not the original genetic material that's injected. The reason I'm asking is to understand how the vaccine designers determine if there are any long-term effects of having this artificial material inside your body. They couldn't have tested it over a long time frame given how quickly all this moved.
- fabian2k 6y agoThe mRNA is stable for a few hours or so, it is both chemically unstable in solution under the conditions in a cell and also actively degraded by various mechanisms.
- outworlder 6y ago> The reason I'm asking is to understand how the vaccine designers determine if there are any long-term effects of having this artificial material inside your body The properties of mRNA are well known and have been for decades. Your cells are constantly producing more from the nucleus. It degrades, even more so when it gets transcribed. That's the beauty of this, it's self-limiting. The only 'artificial' thing about it is the special base that's added to avoid detection by the immune system. Everything else is the exact same compounds present in your cells.
- controlweather 6y ago7 years from now everyone is infertile. Wonder why
- aty268 6y ago'A group of Stanford researchers has hacked Moderna’s messenger RNA (mRNA) vaccine for the novel coronavirus, Motherboard first reported on Monday, and published its entire genetic sequence on the open-source code repository Github.' https://gizmodo.com/stanford-scientists-post-entire-mrna-sequence-for-moder-1846576268 https://gizmodo.com/stanford-scientists-post-entire-mrna-seq...
- throwawaysea 6y agoWhat does "hacked" mean here? The article makes it sound like this wasn't something illegal: > Fire and Shoura told Motherboard that they had received permission from the FDA to collect scraps of vaccines that wouldn’t have otherwise been used from empty vials and that they’d notified Moderna in advance of their plans to publish the sequence without receiving any objection in turn. Also: > The research team told Motherboard that they didn’t “reverse engineer” the vaccine, they simply “posted the putative sequence of two synthetic RNA molecules that have become sufficiently prevalent in the general environment of medicine and human biology in 2021.” I'm not familiar enough with how these sequences to work to understand what's being discussed. Is it simply that they took a sample of the vaccine and studied its composition using some standard machine/process?
- obilgic 6y agoso how are the first and the second dose different?
- meepmorp 6y agoThey're the same. It's just a second dose as a booster.
- hfjfktmtkrn 6y agoThe second dose is like seeing someone stalking you for the second time. You should really do something about it because it's probably serious. The same way, the immune system gets really triggered when it sees the same thing which it supposedly cleared at a later date.
- jonbaer 6y ago"Some vaccines require two doses because the immune response to the first dose is rather weak. The second dose helps to better reinforce this immune response." - I would have to think over time that could be optimized somehow to just require one w/ ML and test results, etc.
- takeda 6y agoI believe only Sputnik vaccine has different first and second dose, but their vaccine is of different category (it belongs to the same as AstraZeneca and Johnson and Johnson). The reason is that these vaccine use a vector (adenovirus) and there's a risk that body will develop antibodies for the vector and the second dose might not be as effective.
- brian_herman 6y agohttps://github.com/brianherman/Assemblies-of-putative-SARS-CoV2-spike-encoding-mRNA-sequences-for-vaccines-BNT-162b2-and-mRNA-1273 https://github.com/brianherman/Assemblies-of-putative-SARS-C... I posted some txt files with the lines removed and stuff.
- flobosg 6y agoIf you have the time, it would be nice to transfer the data to the commonly used Genbank format.
- deleted 6y ago[deleted]
- brian_herman 6y agohttps://github.com/brianherman/Assemblies-of-putative-SARS-CoV2-spike-encoding-mRNA-sequences-for-vaccines-BNT-162b2-and-mRNA-1273/blob/main/moderna.gb https://github.com/brianherman/Assemblies-of-putative-SARS-C...
- brian_herman 6y agoAsk and ye shall recieve! Have a great day!
- zappo2938 6y agoWow Looks like it is analogous to having a header on a TCP packet. [0] Here is an animation of mRNA encoding translated to proteins inside a ribosome. [1] "The ribosome is composed of one large and one small sub unit that assemble around the messenger RNA, which then passes through the ribosome like a computer tape. The amino acid building blocks, that's the small glowing red molecules, are carried into the ribosome attached to specific transfer RNAs; that's the larger green molecules also referred to as tRNA. The small sub unit of the ribosome positions the mRNA so that it can be read in groups of three letters known as a codon." Very analogous indeed. [0] https://xerocrypt.wordpress.com/2014/07/22/how-to-read-almost-raw-tcpip-packet-headers-without-the-tools/ https://xerocrypt.wordpress.com/2014/07/22/how-to-read-almos... [1] https://www.youtube.com/watch?v=TfYf_rPWUdY https://www.youtube.com/watch?v=TfYf_rPWUdY
- retrac 6y agoSome parts of gene transcription are so straightforward one can almost be tricked into thinking it has the logic of a computer program. It may be an illusion. To stretch the metaphor, TCP parsers don't match probabilistically along the entire length of the packet in parallel, and they don't interpret the same part of a packet as data in some contexts, and a header in others.
- robbiep 6y agoI ended up majoring in biochemistry and molecular biology in my undergrad because I was browsing on Wikipedia one day and came across an article written on an E. Coli variant that had sentences like: 01J3 e. Coli has a DNA Polymerase that contains 3k’-5’ proofreading capability and 5’-3’ error correcting with a polymerisation rate of 50bps I’ve made the above up because I have never been able to find a Wikipedia page winxe that as succinctly pointed out to me that biology was a machine and I was hooked
- deleted 6y ago[deleted]
- jturolla 6y agoPlease someone... create some abstraction language for this bio-assembly code. Can we make LLVM compile this? :joy:
- jakeogh 6y agoCheckout https://github.com/clasp-developers/clasp https://github.com/clasp-developers/clasp "Clasp: Common Lisp using LLVM and C++ for Designing Molecules": https://www.youtube.com/watch?v=0rSMt1pAlbE https://www.youtube.com/watch?v=0rSMt1pAlbE
- wonderwonder 6y agoWe are simply programmable machines, its pretty interesting that all of human life can be reduced down to 30k editable microservices.
- 8note 6y agoThat gives me the feeling that those reflexion models could do some help for improving our understanding of those microservices
- deleted 6y ago[deleted]
- hutzlibu 6y ago"its pretty interesting that all of human life can be reduced down to 30k editable microservices." I don't know much about DNA and co, but it sounds as microservice is not the right metapher. Rather just 30k sourcecode? Because a microservice is something that is already compiled and running..
- wonderwonder 6y agoWas looking at it as each gene is a microservice and performs a role. Those microservices can be added to, edited / eliminated or swapped out.
- qbasic_forever 6y agoSure, but if you took that 30k of data and dropped it on a planet just like earth it would still take 10k years or so for us to build civilizations as we know it again.
- ngcc_hk 6y agoNot 10k year as it needs to go through the million years scale - rna, hot, uv then dna ... with no oxygen to oxygen etc. Then million of years of evolving ... scale is a bit off.
- drtz 6y agoI'm sure it's more complex than I grasp as a layperson, but I'm utterly amazed at how simple this _appears_. I get the feeling that this is something I have a better chance of understanding than the average SaaS Terms and Conditions. I expected to have to scroll through pages upon pages of indecipherable text. Instead it's no bigger than a large paragraph of text, and I can easily fit it on my screen.
- flobosg 6y agoSequencing technologies have improved immensely over the last decade and a half. And, in this particular case, getting the sample RNA is incredibly easy, since its purity and integrity in the vial is quite high.
- shellfishgene 6y agoI didn't look at the details of how they sequenced it, but given that there are chemically modified bases in the mRNA vaccines there is a chance the normal methods for sequencing (and the first step of translating to DNA) don't work. Well, I guess in practice they did.
- flobosg 6y agoWhile not completely equal to the naturally occuring bases, the modified bases in the vaccine mRNA need to be able to complement to the non-modified ones present in tRNA anticodons during translation. If they can pair to their corresponding natural bases, then the chemically modified RNA can be also used as a template by the reverse transcriptase to generate the complementary DNA needed for the sequencing reaction.
- shellfishgene 6y agoGenerally I agree, but it could be the case that the modified bases work just well enough for tRNA matching in the ribosome, but not with the reverse transcriptase.
- koeng 6y agoThe thinking behind attaching a PDF with colors and not a Genbank file is why we can't have nice things in biotechnology.
- rubatuga 6y agoWait, you mean you don't extract genomic data from Excel? The MARCH1 gene brings many interesting surprises.
- chromatin 6y agoI am fond of September 2, myself. For those not in the know: https://genomebiology.biomedcentral.com/articles/10.1186/s13059-016-1044-7 https://genomebiology.biomedcentral.com/articles/10.1186/s13...
- mmmrtl 6y agoNow SEPTIN2! (and MARCHF1)
- perl4ever 6y agoExcel finally has a facility for manipulating data that keeps it where you put it. It also incorporates a fairly decent functional programming language. It's called Power Query, not to be confused with all the other things that MS has named starting with "Power" and have no relationship at all and are mostly awful. The only real annoyance I have with it is that the editor window is modal, like it blocks all the spreadsheets you have open on your machine, and it's primitive even compared to VBA, especially for debugging. It's not just that it's given me the experience of "this is the way a spreadsheet or BI tool should work" but also "this is the way SQL should work". It's a little cumbersome to do the standard SQL-type operations, but the clean integration of functions means you can implement anything that's missing. Like say, Oracle has grouping sets - you can, and I did, just write a function to do that. I always felt that having a separate procedural language in your database was wrong, but I'd never seen the alternative until now. And I've been falling in love with higher order functions.
- andrewcl 6y agoCool, but it's the lipid delivery system that is the secret sauce. This is equivalent to giving the source code without a compiler to build it.
- airhead969 6y agoWouldn't the "compiler" be the bioreactor used to mass-produce it and the "installer" be the lipid encapsulation? :)
- snuxoll 6y agoInstallGene by Flexera
- Haemm0r 6y agoJust waiting for first copy protection mechanism for mRNA. SafeGene and SecuGene here we come :o
- aneutron 6y agoCan you imagine, the greedy folk would want some sort of Widevine in humans.
- Haemm0r 6y agoThe vaccine will check your implanted payment chip receipt number before activating the payload.
- airhead969 6y ago"Drink Brawndo, The Thirst Mutilator." in your DNA too. Sony is gonna sneak in some DRM and Mark Russinovich is gonna put out a fix.
- airhead969 6y ago"The authorization server is down, no longer signing this version of this medication, or this medication has expired. Please contact your supplier for more information." Shit, I'm going to have to google for a working hex edit or look for a bpatch.
- sp1rit 6y agoIf my little knowledge from biology class serves me correct, RNA uses Udenine instead of Thymine. But in this document it uses T. Can somebody explain to me why?
- rolph 6y agoDNA uses base pairs [A,T] and [G,C], this code is for a piece of DNA,. if you keep a DNA sequence in vials for later use, that is much more stable and easier to manipulate, and repair when corrupted. normally RNA in vivo is complexed with protiens that prevent RNA from folding, and annealing into structure that is not compatible with translation to protien. In the vaccine this isnt happening, this is why RNA is hard to work with and the vaccine must be kept so cold. This is not to say that DNA is simple to work with, but it solves problems if you dont need direct access to RNA.
- feanaro 6y agoYou probably mean uracil, not udenine (which doesn't exist AFAIK).
- sp1rit 6y agoYeah, English is my second language. I just thought of a Translation that sounded reasonable rather than looking it up.
- koeng 6y agoDNA is way more stable than RNA. Since you can easily synthesize RNA from DNA, and DNA synthesis technology is much more mature, folks normally synthesize DNA and then derive/make the RNA from it. That makes most researches default to DNA 5' to 3', even when talking about RNA.
- Laforet 6y agoThe convention of genomic research is to present all RNA sequences as equivalent cDNA sequences. As this will be the output of most common sequencing platforms. https://bioinformatics.stackexchange.com/questions/11353/why-does-the-fasta-sequence-for-coronavirus-look-like-dna-not-rna https://bioinformatics.stackexchange.com/questions/11353/why...
- ur-whale 6y agoWhat this does, as a non-biotech person, I believe I understand at a high level: plonk this code into a ribosome and out comes the desired protein. What I don't understand is: a) how the m-RNA code relates to the produced protein (i.e I can read C-code and get an idea of what is does fairly quickly, but can the same be said of m-RNA and the resulting protein)? b) how did they get their hands on that code in the first place? Do the coronaviruses use m-RNA as well? Was then a coronavirus somehow "dissected" to get at the spike protein "source code"?
- flobosg 6y agoa) Yes, you can translate a mature[1] mRNA sequence, codon by codon, from the start until the stop codon, and it will give you the sequence of the protein it encodes. b) Coronaviruses have a RNA genome. Researchers extracted it from wild-type viruses and then sequenced it. [1]: mRNAs can undergo several maturation steps, such as splicing, which removes regions that won’t be translated into protein.
- koeng 6y agoAnswers: a) From the mRNA you can learn the amino acid sequence of the protein very quickly. You absolutely cannot (yet) learn the function of the protein from that sequence - normally, people just do comparisons with proteins whose functions ARE known. Oftentimes in enzymes there are "domains" or little functional regions that stay consistent over long periods of time, so that's a good way to assign function (given knowledge of other proteins in the same family) b) Yep. Every virus at some point in their lifecycle use mRNA. You can just sequence the virus and get all that data (I've done that on SARS-COV-2, it's honestly pretty easy). Then you just do homology alignment (as stated above) and you can figure out approximately what each gene does. The problem of de-novo protein prediction is ONE OF THE HARDEST PROBLEMS IN BIOTECH, but just like getting amino acid sequence, doing homology searches, sequencing viruses, etc, is basic biotech and I'd expect an eager high schooler or undergrad to be able to do them.
- ur-whale 6y agoThanks !
- flobosg 6y ago> So how different is the mRNA in the Moderna, BioNTech/Pfizer & CureVac vaccines? There are 1274 codon positions. 808 are identical across all 3 vaccines. 103 are unique to Moderna, 249 unique to BioNTech, 230 to CureVac https://twitter.com/PowerDNS_Bert/status/1375091898797453326 https://twitter.com/PowerDNS_Bert/status/1375091898797453326
- nsxwolf 6y agoELI5, Why are the sequences different if they result in the same spike protein?
- shakow 6y agoI didn't check it was the only explanation, but the DNA -> protein encoding is surjective.
- rnestler 6y agoMaybe one could compare it to having different recipes for the same cake. Or different source code to solve the same problem.
- ssijak 6y agoDifferent codons can encode the same amino acids, so different sequences can encode the same protein.
- p0rkbelly 6y agoobligatory: "I could have done this in a weekend"
- joeyh 6y agoMy first thought was `wdiff pdizer moderna`. It's short enough to post here in its entirity, but I guess I had better not, anyway it's easy enough to extract from the pdf. Add a space after every letter and wdiff can find the common sequences nicely. Short except for flavor, this is from near the beginning: A[-G-]AGA{+A+}GAA{+ATATAAGAC+}CCCG{+GCGCCG+}CCACCATGTTCGTGTTCCTGGTGCTGCTGCC[-T-]{+C+}
- koeng 6y agoUs folks in biotech have a special tool just for this :) https://blast.ncbi.nlm.nih.gov/Blast.cgi https://blast.ncbi.nlm.nih.gov/Blast.cgi Unfortunately, the core algorithm dates back to 1990, so it can be real slow in some cases. Biotech takes a while to improve :(
- flobosg 6y agoI think you meant https://www.ebi.ac.uk/Tools/psa/emboss_needle/ https://www.ebi.ac.uk/Tools/psa/emboss_needle/ or https://www.ebi.ac.uk/Tools/psa/emboss_water/ https://www.ebi.ac.uk/Tools/psa/emboss_water/ ;-)
- asdff 6y agoYou can also run blast locally if you need to throw more hardware at it.
- flobosg 6y agoA pairwise sequence alignment done with `needle` starts like this: BioNTech_Pfiz 1 -----------GAGAATAAACTAGTATTCTTCTGGTCCCCACAGACTCAG 39 |||||.|.|..|||| ||| || Moderna 1 GGGAAATAAGAGAGAAAAGAAGAGTA----------------AGA---AG 31 BioNTech_Pfiz 40 AGAGA----AC-------CCGCCACCATGTTCGTGTTCCTGGTGCTGCTG 78 |.|.| || |||||||||||||||||||||||||||||||| Moderna 32 AAATATAAGACCCCGGCGCCGCCACCATGTTCGTGTTCCTGGTGCTGCTG 81 BioNTech_Pfiz 79 CCTCTGGTGTCCAGCCAGTGTGTGAACCTGACCACCAGAACACAGCTGCC 128 ||.||||||..|||||||||.|||||||||||||||.|.||.|||||||| Moderna 82 CCCCTGGTGAGCAGCCAGTGCGTGAACCTGACCACCCGGACCCAGCTGCC 131
- plattyp 6y agoWho would have thought it'd be this simple if covid?(dna) block_virus(dna) end
- rantwasp 6y agoread the article linked in the thread. it actually does not work against all of the covid virus. it works against the spikes. so, the virus is sort of like a ball with these spikes on top (that’s where the corona name comes from) and the vaccine helps your body develop antibodies against the spikes. so when the virus gets in your body, it actually receives a “haircut” which leads to it no longer being able to enter the cells and hijack their internals to produce more viruses. it’s extremely clever, but it also means that your code is wrong ;))
- bvanderveen 6y ago> .docx.pdf Cargo-cult much?
- savrajsingh 6y agoMy question is does the Johnson & Johnson DNA-based vaccine encode for the exact same spike protein, or a different one they chose to target? From this PDF I conclude both the moderna and Pfizer vaccines target the same protein.
- rjvir 6y agoThis should be an NFT, I'd love to own an NFT of the RNA sequence of the Moderna vaccine.
- stevefrench93 6y agoI wouldn't install beta software on a production system though.
- rossdavidh 6y agoWell we do with anti-malware stuff, when a 0-day comes out and we know there are exploits in the wild and beta software is all we've got.
- bigbob2 6y agoLuckily in that case there is usually a means to roll back.
- buttholesurfer 6y agoStill not taking it.
- jonplackett 6y agoRather disappointingly, neither sequence includes the string 'GATTACA'
- ImaCake 6y agoA given combination of 7 bases has a probability of occurring of 1/16,384. Since the COVID genome is about 22k bases long I guess you have pretty good chance of it appearing in there somewhere. This assumes uniformity, which of course is not true. COVID’s genome is under crazy intense selection pressure!
- shellfishgene 6y agoThe sequence GATTCA appears 4 times in the reference version of the COVID genome :) (Go to https://www.ncbi.nlm.nih.gov/nuccore/NC_045512 https://www.ncbi.nlm.nih.gov/nuccore/NC_045512, pick "Find in this Sequence" on the right)
- jonplackett 6y agoAWESOME! I just did a text search for it on github. Maybe it didn't pick any up that had a line break in the middle. I'm much happier now.
- ImaCake 6y agoYep, the usual coding tools aren't ideal for bioinformatics. We have our own set of tools that work well with the various "standard" formats for sequence data.
- joe45643234 6y agoWhats special about this string?
- Duber 6y agoIt´s the title of a cult film: https://www.imdb.com/title/tt0119177/ https://www.imdb.com/title/tt0119177/
- djmips 6y agoWhere's the JSON versions?
- flemhans 6y agoDespite how complex this really is, and how many "gotchas" there might be when using this repository, it's nice that it gets a shitload of attention. As a united humanity we should strive to solve our common problems.
- narrator 6y agoSo I guess Josiah Zayner has to pick up on this now and do a DIY Moderna COVID vaccine video. He already did a DIY vaccine video with full open source documentation on how to do it yourself. http://www.josiahzayner.com/2020/12/i-made-covid-19-vaccine-in-my-kitchen.html http://www.josiahzayner.com/2020/12/i-made-covid-19-vaccine-...
- ibraheemdev 6y agoIs this all another medical company needs to start manufacturing and selling the vaccine themselves? Or is this sequence licensed/proprietary in some way?
- akkawwakka 6y agoNo. The RNA still needs to be fit in a lipid nanoparticle which is Moderna and BioNTech’s secret sauce.
- mrfusion 6y agoSo what moves the new protein out of your cells once the rna is processed? Don’t most proteins stay inside the cell?
- lowdanie 6y agoThere is a system that transports protein fragments to the cell surface and “presents” them to the immune cells: https://en.m.wikipedia.org/wiki/Antigen_presentation https://en.m.wikipedia.org/wiki/Antigen_presentation
- mrfusion 6y agoThanks. So what makes that happen in this case? Is it because internally the cell doesn’t recognize the protein? Or it does this for all proteins it makes? Does say some hemoglobin get transported to the cell surface?
- lowdanie 6y agoYes, the even healthy cells are constantly transporting protein fragments to the cell surface but the immune system learns to ignore these as it is developing. In addition, B and T cells only detect fragments on the surface of active Dendric cells. Dendric cells become active in response to alternate and less specific indications of infection such as an unusually high amount of mRNA translation or families of protein that occur only in bacteria and viruses.
- mrfusion 6y agoThe lipid container is weird to me. Is that all it takes to send instructions inside a cell? Seems like a security hole. Why haven’t viruses evolved to have a lipid container?
- inportb 6y ago> Why haven’t viruses evolved to have a lipid container? They have. https://en.wikipedia.org/wiki/Viral_envelope https://en.wikipedia.org/wiki/Viral_envelope
- jforman 6y agoI was going to say you can't get very far without a protein vehicle, but then I remembered that's quite incorrect: https://en.wikipedia.org/wiki/Retrotransposon https://en.wikipedia.org/wiki/Retrotransposon The injection is important, however, as it gets the genetic material past a whole lot of nucleases that cover your epithelia.
- The_rationalist 6y agoI would love to see the output structure from Alphafold of this RNA source code
- ineedasername 6y agoIt's also short enough to post the whole thing to Wikipedia, so that's probably inevitable along with some very entertaining edit wars.
- karolkozub 6y agoIt looks like a machine code snippet. I wonder if we'll develop high level languages and compilers for genetic code in the future.
- ImaCake 6y agoI imagine we have tools in that direction, but nothing complete. Unlike math and computers, biological systems don’t really go from a uniform set of simple rules to emergent complexity - there is a whole lot of sideways complexity thrown in. Something that might fit the computation vision of your comment are the various Ontologies for bioinformatics. The Gene Ontology is probably the most complete, although it lags many years behind the literature. http://geneontology.org/ http://geneontology.org/
- squarefoot 6y agoAs a software/hardware guy who knows less than zero about the subject: is this something that (given the right resources) makes possible to replicate the vaccines? I mean in countries where they can't afford enough vaccines but already have or could invest in the ability to replicate them without caring about patents.
- a-dub 6y agoi'm a dna noob: is it possible to do the growing and sampling thing to get the sequence from a sample of the vaccine or does the bubble of fat get in the way?
- person_of_color 6y agoHow long before we can 3d print an mRNA vaccine?
- singularity2001 6y agotangential: do biologists sometimes use some form of base 64 encoding for their triplets? so instead of AAG.TCA.GGA just g5F or something? other than the obvious advantage of being shorter, it would also be easier to read: the boundaries would be unambiguous and each char would correspond directly to and amino acid (if applicable/coding)
- jebus989 6y agoProteins are written in standardised IUPAC amino acid codes that carry some semantic meaning, e.g. Alanine: A, Glycine: G etc. Also viral genomes often have overlapping transcription with shifted open reading frames. Biology is not as simple as you think.
- aden1ne 6y agoWhy not in fasta format?
- csense 6y agoThe Human Genome Project was completed almost two decades ago, and somebody solved the protein folding problem recently. Why are we still doing genetics at the machine code level? Shouldn't we have some compilers, assemblers and linkers by now?
- WJW 6y agoI feel this XKCD describes the situation particularly well: https://xkcd.com/1831/ https://xkcd.com/1831/
- neuronic 6y agoMaybe after 4 billion years of evolving our code we will get it right.
- baby 6y agoMy thought exactly. So this thing is like a VM with a bunch of primitive opcode, why can’t someone write a higher-level language or at least some gadgets
- WJW 6y agoThe problem with trying to program genetics is that there is a bunch of code already running on the system and every variable is a global. You can't just start up a new program with minimal impact on the stuff that is already running, like you can in most human-made computers. Also don't forget that the extremely simplified version of the running system looks like this: https://www.sigmaaldrich.com/technical-documents/articles/biology/interactive-metabolic-pathways-map.html https://www.sigmaaldrich.com/technical-documents/articles/bi...
- flobosg 6y agoI wouldn’t call it extremely simplified; you can go simpler: https://science.sciencemag.org/content/351/6280/aad6253 https://science.sciencemag.org/content/351/6280/aad6253
- 6y ago
- omlet 6y agoWhere is the 5G stack?
- omlet 6y agoWhere is the code about 5G modem?
- dooopy 6y agoI compared the spike encoding regions, and it looks like they're quite different...I wonder if the codons wind up coding for different amino acids. And who got it right?
- flobosg 6y agoTheir codon compositions were optimized differently, but both coding regions translate to the same amino acid sequence.
- em3rgent0rdr 6y agoAre there any visual compilers that simulate the process of using these sequences to assemble a protein?
- tibbydudeza 6y agoSo you have a header/footer sequence that we sort of know is required (remember the MZ and chksum for .EXE files) but we have no idea what that bits in between does except we can read the letters and copied it in part from the actual virus.
- 6nf 6y agoWe do know that bit in the middle encodes the structural spike protein of the virus
- verytrivial 6y agoThere are people who could memorize this. And it would weirdly be more useful than digits of π!
- whitepaint 6y agoI think memorizing any of these two is pretty much totally useless.
- anonu 6y agoThis is amazing. It appears quite "simple" - of course I know nothing about this part of the sciences. I do think back to the early days of Covid when there were all these predictions around when a vaccine would show up. It seemed like there was knowledge that the mRNA platform would be the likely solution and probably by April we knew a vaccine would be possible - it just took 6+ months to test. Thinking about that timeline amazes me.
- bionhoward 6y agowe wrote some code last year to build a big Trie of the whole transcriptome -- you could use it to fuzzy-search to see if this mRNA is within some edit distance of any piece of normal human RNA, because then it could theoretically cause side effects via RNA interference. stopped the project because I can't afford to develop a gene therapy right now, but the fuzzy search worked https://github.com/bionicles/coronavirus https://github.com/bionicles/coronavirus to make the trie use the function here. the variable K is the length of the Kmers (runs of RNA). Larger values are gonna take a lot longer. ( warning: big job, uses multiprocessing...pypy recommended for speed ) https://github.com/bionicles/coronavirus/blob/b6f0db9dd8aaf7475aebd75dfcafe77194a65e8d/bio_firewall.py#L100 https://github.com/bionicles/coronavirus/blob/b6f0db9dd8aaf7... then you could use this recursive function to generate potential matches within some cutoff https://github.com/bionicles/coronavirus/blob/b6f0db9dd8aaf7475aebd75dfcafe77194a65e8d/bio_firewall.py#L174 https://github.com/bionicles/coronavirus/blob/b6f0db9dd8aaf7... the function right below it converts the generator to a list. then you could save that enjoy
- husamia 6y agoif you have understanding of how the sequence mutates then you can predict what the next strain is going to be and design spike protein that matches it.
- sktrdie 6y agoNo package.json found, won't install.
- andred14 6y agoNo thanks I'm good
- stjohnswarts 6y agoELI5 could this be used by "evil governments" to make designer pathogens to release during doomsday situations (say by North Korean leaders in their suicide bunkers if things went badly) ?
- spullara 6y agoI highly recommend reading about Ribosomes. They are made up of two pieces that were likely independent at some time. It becomes quite clear that "life" began as a machine that all it could do was replicate itself: https://en.wikipedia.org/wiki/Ribosome https://en.wikipedia.org/wiki/Ribosome You can think of RNA as a copy of a section of DNA. They look very much like computer programs except rather than producing code, the Ribosome can read them and translate each codon for an amino acid into its corresponding actual amino acid that it then binds together into a protein. The execution engine is the environment of the cell. All highly probabilistic rather than deterministic. I can't imagine any programmer not finding them completely fascinating.
- StaticRice 6y agoArchive.org mirror: https://web.archive.org/web/20210326214140/https://raw.githubusercontent.com/NAalytics/Assemblies-of-putative-SARS-CoV2-spike-encoding-mRNA-sequences-for-vaccines-BNT-162b2-and-mRNA-1273/main/Assemblies%20of%20putative%20SARS-CoV2-spike-encoding%20mRNA%20sequences%20for%20vaccines%20BNT-162b2%20and%20mRNA-1273.docx.pdf https://web.archive.org/web/20210326214140/https://raw.githu...
- pknerd 6y agoCan someone give me the link of FASTA files of these sequences?
- peter303 6y agoOne of Modernas cofounders, MIT Prof Robert Langer, was profiled on 60 Minutes a few years back as MITs most prolific patent holder. He specialized in nanoparticle delivery systems to any desired internal tissue. One can deliver medicine, nutrients, diagnostics, etc where and when they want. Vaccines are just a small of subset of these applications.
- calltrak 6y agoTwo rats were discussing the covid vax. One rat says to the other, hey are you going to get the covid jib jab? And the other rat replies. Are you completely mad in the head? Sure they have not finished with the testing and the human trials yet. https://brandnewtube.com https://brandnewtube.com has lots of eye opening information for those inquiring minds who have discerned that with regards to the covid story, something does indeed smell like a rat.
- mushroomzulu 5y agohttps://www.instagram.com/tv/CIYYq_rCV9F/?utm_source=ig_web_copy_link https://www.instagram.com/tv/CIYYq_rCV9F/?utm_source=ig_web_...