fwip

34 ms·

811.
by fwip 1y ago
Yes, because most men won't live to be 82, so on average it's not worth it. But presidents are not "most men." They're also attended by personal physicians who can keep them from freaking out when informed accurate
812.
by fwip 1y ago
LinkedIn isn't old enough to have anything ancient. It was launched in 2003, and even then you'd get laughed at for suggesting storing passwords in plaintext.
813.
by fwip 1y ago
Sure, if you're happy eating the dogshit that is AI.
814.
by fwip 1y ago
Huh, I don't find the number row very difficult to touch type. But then again, I do have long fingers.
815.
by fwip 1y ago
Not really. Delivering gene edits via CRISPR in this way is more like editing a text file with a single application of a regex - `s/ACTGACTGACTG/ACTGACTGAAAAAAAACTGACTG/g`.
816.
by fwip 1y ago
For me, "Motie engineering" always brings to mind "The Story of Mel." http://www.catb.org/jargon/html/story-of-mel.html
817.
by fwip 1y ago
The official rules include this interesting bit: > Solutions must be in either rav1d itself, the Rust compiler (inclusive of llvm), or the Rust standard library.
818.
by fwip 1y ago
At least some Kaby Lake CPUs are affected, but they can't say for sure that all of them are.
819.
by fwip 1y ago
24.04 is an LTS (long term support) release, so it receives updates, including security updates, for much longer than a regular release. I believe it's a 5-year support window, and longer if you shell out for paid support.
820.
by fwip 1y ago
Right - a study found that the majority of bus riders were women, but previous designers were mostly men. So they surveyed them, found out that one of their top priorities was shade, and designed a relatively inexpensive way to provide it.
821.
by fwip 1y ago
As somebody who took daily bus trips for nearly a decade of my life, I would definitely prefer the meager shade from these to the bare bus stops they were replacing. Standing in the sun for even fifteen minutes waiting for a bus can be mise
822.
by fwip 1y ago
The agricultural revolution was roughly 10,000 BC, wasn't it? Your sources are more recent than that, and so don't disagree with the point the parent post was making.
823.
by fwip 1y ago
Really? I haven't tried Gemini 2.5 yet, but my main complaint with Claude 3.7 is this exact behavior - creating 200+ line diffs when I asked it to fix one function.
824.
by fwip 1y ago
Could be a bit of a "it's always in the last place you look" kind of thing - if Claude or CGPT had gotten it right, you wouldn't have tried Gemini.
825.
by fwip 1y ago
So, if that were so, then an LLM possess no knowledge whatsoever, and cannot ever be trusted. Is that the line of thought you are drawing?
826.
by fwip 1y ago
Exactly - if even the doctors/clinicians are not "prompting it right," then what are the odds that the layperson is going to get it to behave and give accurate diagnoses, rather than just confirm their pre-existing biases?
827.
by fwip 2y ago
Unless you were running the model locally in a way you control, it seems very possible that the model has additional hidden context regarding your location (perhaps based on IP, perhaps based on credit card billing information, etc).
828.
by fwip 2y ago
*eminent domain, from a Latin-ish phrase "dominium eminens."
829.
by fwip 2y ago
Stock is only one part of capital formation, and of that, algorithmic trading is only incidental to the sale of those stocks. Put another way - capital was accrued long before we had a stock market, and even longer before we had computers d
830.
by fwip 2y ago
You're right, I spoke too broadly there.
831.
by fwip 2y ago
Finance is sort of a unique beast in that the field is inherently negative-sum. The profits you take home are always going to be profits somebody else isn't getting. If you're doing like, real work, solving problems in your domain
832.
by fwip 2y ago
AI has a long way to go before it can serve as a trustworthy middleman between research papers and patients. For instance, even WebMD might waste more time in doctor's offices than it saves, and that's a true, hallucination-free s
833.
by fwip 2y ago
The latter - he valued loyalty over competency (ending up surrounding himself with yes men), and demanded too much of the competent folk until they burnt out and left.
834.
by fwip 2y ago
Read it for the first time just now - it seems to me that Pierrot has stolen the narrator's purse (under the guise of dusting the chalk from their cloak) and successfully convinced them to blame Truth, instead. There's almost cert
835.
by fwip 2y ago
Sure there is. If you want to know if students understand the material, you don't hand out the answers to the test ahead of time. Collecting a bunch of "Hard questions for LLMs" in one place will invariably result in Goodhart
836.
by fwip 2y ago
The small and successful company (~100 people) my brother-in-law works at is currently self-destructing, specifically because the CEO is that exact kind of family-loyalty "father figure" wannabe.
837.
by fwip 2y ago
When you have enough money that you no longer do work for more?
838.
by fwip 2y ago
Assuming you're serious, there are two main reasons. You want to regain storage space after you delete things, and sometimes you want to actually delete things (e.g. to be in compliance with regulations).
839.
by fwip 2y ago
One thing I notice is that they specify that the robot has never seen the homes before, but certain objects, like the laundry baskets, are identical. Doing your demo is significantly easier if you've already programmed/trained t
840.
by fwip 2y ago
The text is lifted from a scene in The Office: https://youtu.be/gO8N3L_aERg?si=y7PggNrKlVQm0qyX&t=82

More ›