7 ms·
Not really. Delivering gene edits via CRISPR in this way is more like editing a text file with a single application of a regex - `s/ACTGACTGACTG/ACTGACTGAAAAAAA
by fwip 1y ago
Not really. Delivering gene edits via CRISPR in this way is more like editing a text file with a single application of a regex - `s/ACTGACTGACTG/ACTGACTGAAAAAAAACTGACTG/g`.
- anthk 1y agoSo, Perl or sed. If it's Perl, the guy from XKCD was right. And, maybe, Larry Wall.
- xarope 1y agoTIL my years of perl regex'ing was preparing me for a future of DNA gene warfare (core war, anybody?)
- duskwuff 1y agoI don't know if it still is, but, for a while, Perl was actually fairly popular in bioinformatics: https://bioperl.org/ https://bioperl.org/