dwild

52 ms·

421.
by dwild 7y ago
> A very significant proportion of your potential users will either keep it disabled Then they made the conscious choice that their usage won't get known and thus be aware that another way of communication will have to be used. >
422.
by dwild 7y ago
> Why would he expect aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa to be less random than for example acatgagacgtctaatgttagacatgcatgac? Can we really consider any part of a genome random? I means your second example isn't part of it, so I gues
423.
by dwild 7y ago
>Yet another reason not to put telemetry in your software. Can you explain a bit more your way of though? How should you decide what to support if not having the information from your user? The only other alternative is to ask, and then
424.
by dwild 7y ago
> The article talks mostly about e-mail and search, but you know what's still the best social network on the interwebs? E-mail. I'm pretty sure if you replaced "social network" by "ticket tracker", you would
425.
by dwild 7y ago
> If it's going to save you your afternoon - just do it. That's the thing, will it actually be used like that? This feel so casual that it doesn't feel like it has to be used in urgent matter only. I guess the important th
426.
by dwild 7y ago
> my behavior is not abusing the content creator in any way Abuse[0]: Abuse is the improper usage or treatment of a thing, often to unfairly or improperly gain benefit. You go somewhere that use ads to finance the content, while making e
427.
by dwild 7y ago
Why not link the original twitter post[0] instead? That page add nothing but ads. [0] https://twitter.com/IamShaneMorris/status/122036793494775808...
428.
by dwild 7y ago
You are under no obligation to read that content either... seems like the abuse actually come from you that did made the conscious choice to go there.
429.
by dwild 7y ago
$100k a month with 400,000 to 700,000+ page views a month?! Let say that she does that with 700k pages views months, that means an ECPM of 142$! She get 1$ out of every 7 views! I kind of feel weird that she get so much money out of people
430.
by dwild 7y ago
It certainly can, either by detecting the sentence structure, or even more simply, by tagging them all as warning. You then go over them one by one and it can remind you of the difference and ask you whether you used the right one.
431.
by dwild 7y ago
> Also, spell-check telling you there's an error isn't the same as automatically fixing the errors and hiding that there was ever an issue... so I think the right click/see list of likely words / pick one is still a l
432.
by dwild 7y ago
> The videos are more about funny jokes than the different phases of matter. I learn so much better when I'm interested in what I learn, making it funny can be a good way to learn it. > I don't want to have to sit next to th
433.
by dwild 7y ago
> Surly those must struggle to break even? Wouldn't a higher fee, and, more importantly, nearly-zero costs be exactly what you want for a charity run? The one for 35$ wasn't the charity run, that was the commercial one. The cha
434.
by dwild 7y ago
Most productions works like that. You create a single thing, when that thing is done, the work is done. TV shows and movies doesn't need updates or maintenance (well except Cats ;) ). When you hire a plumber do go in your house, do you
435.
by dwild 7y ago
You got a good point there, CollegeHumor only got 2/3 of views than Linus Tech Tips and their production cost are clearly higher. Should still allow to pay for a smaller staff and hope that they can get enough out of Dropout to pay for
436.
by dwild 7y ago
> Seems like a dramatic announcement if this was just a big downsizing. A dramatic announcement? Their announcement was a few tweets on Sam Reich personnal twitter, which ends with this sentence: Independent comedy lives on -- just now m
437.
by dwild 7y ago
> It's contracted to life support in order to empty the existing pipeline to minimize losses. Is it really life support? Or simply, what is always should have been? Do you really need 100 staffs for College Humor? For the production
438.
by dwild 7y ago
> usually rush to convert it to some other more stable store of value. Any essential consumable without expiration date can be stable store of values. Buy all the beans that you can and store that instead!
439.
by dwild 7y ago
> That sucks that this happens frequently. Never said it happens frequently, I see in average 50 movies a year and I have been doing this for the past 6 years. It's just the good old Murphy's law. There's so much software
440.
by dwild 7y ago
> The people working there can't fix the issue so for next days/weeks this bugs can repeat. They probably have a technician on call which can answer before the next day, but not instantly during an issue. The most likely issue
441.
by dwild 7y ago
> There are also great Javascript platforms for all kinds of purposes these days. Except nothing replace it in a one-stop do it all like Flash was able to do. You open it, you had a timeline that could contains both graphics and code, yo
442.
by dwild 7y ago
> if you make a 3D model all of the sudden the legal system loses it's goddamn mind. This isn't a proof that you can't do it, a DMCA takedown is a way to avoid going to court to prove that you can't do it. I guess you
443.
by dwild 7y ago
> Reddit apparently isn’t in the business of deciding whether or not a claim is legitimate. That's the whole point of DMCA. If Reddit took a side, they would now be responsible for the copyright infringement. They may be able to fil
444.
by dwild 7y ago
You do the same mistake as the other guy in the twitter thread, you mix Simple Hosting snapshots and the Cloud hosting volume snapshot. Here the right one which state that they are backup: https://docs.gandi.net/en/clou
445.
by dwild 7y ago
> The idea that someone would entrust their sole copy(s) of critical business data to a service provider is insane to me. Always keep your own backups. You can consider it insane, they still sold snapshot as being backup. Insane or not,
446.
by dwild 7y ago
That's really nice then!
447.
by dwild 7y ago
> nobody's "expecting" you to keep them in all the time, I do expect to keep them on, they are expensive device and I won't open the little carrying case and put them in each time someone may speak to me. >press a
448.
by dwild 7y ago
> One replacement of the cord generates more plastic waste than the entirety of the airpods I use. The battery is a much bigger issue than the cord. If it get recycled correctly sure, but most people won't recycle it... You are a pr
449.
by dwild 7y ago
> It just makes dealing with incessant city noise so much more manageable. > You don't even have to be listening to music. It does noise cancelling without music? That seems like a bad feature for something that you are expected
450.
by dwild 7y ago
> The original airpods I got 2 years ago still work for about an hour and do fine. In 2 years the battery life fall to 1 hour? This is just crazy unsustainable!

More ›