6 ms·
Is it true? Can Covid-19 vaccines connect me to the internet?
- TobySKT 6y agoFortunately, as healthcare is adopting a more consumer-centric paradigm, we get more options to schedule our medical visits digitally, using doctor appointment booking apps. In this blog, you’ll learn everything you need to know about doctor appointment app development. https://steelkiwi.com/blog/how-to-build-a-doctor-appointment-app/ https://steelkiwi.com/blog/how-to-build-a-doctor-appointment...
- maury91 6y agoI need some clarification on "connect me to the internet", does that means I can watch Youtube videos by simply closing my eyes? I can search on Google with my thoughts? Can I connect to my smart home so I can turn on the lights without saying a word?
- anoncake 6y agoYes. And if you send ${Your bank balance} to 35hK24tcLEWcgZA4JxpöbkNkoAcJGqQP, I'll decrypt your memory on how to do that as well as all your other favourite memories.
- froh42 6y agoNo, it will just post your filthy thoughts to your facebook timelime.
- maury91 6y agoI believe the people that believe in 5G in vaccines are already posting every stupid thought they have on facebook.
- hackflip 6y agoSo in a roundabout way, vaccines ARE connecting them to the Internet!
- deepstack 6y agoWell, we can already use fMRI (maybe EEG as well) or PET scan to read the structure of people's thoughts. And researchers already have done BrainNet, A Multi-Person Brain-to-Brain Interface https://arxiv.org/abs/1809.08632 https://arxiv.org/abs/1809.08632 Science doesn't stay still. Given these it is no surprise that lay person think that this is possible.
- islon 6y agoMost people don't need a vaccine for that...
- TriNetra 6y agowell, you need to be a bit verbose I guess. Smile please, to like and frown to dislike. If you are mad at a post then, you can just smash on the wall to show that reaction on person's FB wall :).
- tpetry 6y agoThe people believing in this „trackable chip“ in the vaccines will not trust a governmental website telling them they are not tracked. Despite this bullshit, having so small internet connected chips would enable a lot new usages. Would be very interesting times.
- thitcanh 6y agoTo be fair, I’m not sure I’d necessarily trust an “injectable” chip that’d be forever lost in my body, unremovable. Subcutaneous chips sound much more reasonable, especially if I can pay with my finger.
- notahacker 6y agoI don't think the question is aimed at the people who believe it's a trackable chip for Bill Gates to control your mind so much as the people who have no clue and know they have no clue but have heard some rumour vaccines have some connection with 5G which is bad, apparently, and want to understand whether it's true. Asking the question in a purposely silly way (is that really what Dave meant when he was talking about 5G?!) and then giving a techy-sounding answer that sounds like they're taking the concern seriously probably does reassure a lot of those people.
- thitcanh 6y agoI’ve never heard this question formulated this way, it’s weird that they would put it in the FAQs unless they’re just taking the piss. A more helpful question would have been “Can I be spied/tracked after I’m vaccinated” or something along those lines.
- krona 6y ago“Can I be spied/tracked after I’m vaccinated” The answer to which is obviously yes. You don't become invisible after taking the vaccines, for example.
- saargrin 6y agoi did see some people who believed there was a literal 5G chip in the vaccine that was injected people who could believe that could believe anything
- senectus1 6y agoJust like the NBN, the Fed Gov have screwed the rollout of 5G I mean the Vaccine as well....
- jarym 6y agoWell I guess we could have solved the rural Internet access problem at the same time as the pandemic but no. Big corporations and governments colluded to prevent that happening. Yes. Sarcasm.
- DyslexicAtheist 6y ago[*tutting sounds*] This is just another example where ETSI and telecommunication standardization missed the boat!
- joshka 5y agoFiber to the hydrogel.
- oytis 6y agoThat's unfortunate.
- bilekas 6y agoThis is wild, like most I think this is a bit of comic relief, but honestly I think even answering this has added some legitimacy to the conspiracy nuts..
- aphroz 6y agoSo now you can be on the first page of HN with an April's fool article on April 7th?
- aaron695 6y agoIts a good example of a disapointing April fools joke polluting a serious issue. People believe it's a serious issue now which distracts from real issues.
- Enderboi 6y agoPost is dated March 30, I'd say sadly this was probably not intended as an April Fools joke. Unless they're using the 'voltswagen' NTP server :P /lamejoke
- rixrax 6y agoMy only question is: can I choose my carrier? I’ll be damned if I’m forced to Sprint network!!! Oh, and another, what kind of plan I am getting, can I upgrade it and most importantly, is it paid for by taxes or will I receive the bills? Either way, I hope it’s tax deductible at least!
- maury91 6y agoNo, it works only with Microsoft. The good thing is that you get a free subscription to xCloud and you can play Xbox with your mind. If you get the extra vaccine you get also bluetooth support and you can use a joystick.
- hobos_delight 6y agoSorry, it's Australia so it's all NBN...
- jumperabg 6y agoWhat about the more expensive ones? Do they have 5G? What about bitcoin mining? Can we mine bitcoin with any of the vaccines?
- Aeronwen 6y agoThe cheaper ones mine bitcoin to subsidize the cost. How fast you gain immunity depends on the market rate of bitcoin and number of other people who have already been vaccinated and are skewing the hash rate.
- chriselles 6y agoOn the one hand believing such things can be viewed as funny. On the other hand it is a quiet serious issue. While deployed to the Solomon Islands 15 years ago in a very remote location, the indigenous folks thought our helicopters were stealing all their gold and diamonds with giant vacuum cleaners in our helicopters. Comically ridiculous, but they were serious as a heart attack. And there were a few very aggressively and violently leveraged those mistaken beliefs. So we had to respond with great care for their concerns rather than just disparaging them. Doesn’t the same apply here? Confirmation bias of internet searches and conformity bias of online fringe communities can lead to quite persistent and amplified opposition.
- TriNetra 6y agoSoon we'd read a story on HN "500 million brains got leaked, terabytes of private thoughts published online" and, a clone of haveibeenpwned will popup asking people to enter their brain scans to check if their brain was in the leaked dataset :)
- _jstreet 6y agoIs this true for all of the Covid-19 vaccinations? The page only references the 'Pfizer mRNA vaccine' one. Curiously, does this mean that the Pfizer vaccine is the only one Australia is using/has access to currently?
- zizee 6y agoActually, Australia will mostly be using the AstraZeneca vaccine, as an Australian manufacturer is licensed to produce it. It's a good thing too that we have a domestic cabability, as other countries appear to be diverting previously promised doses elsewhere because of Australia's successful covid-19 control programs. Note: happy to be corrected on any of this. Also, no judgement on the diverting of vaccine doses to more at risk populations, it seems sensible.
- Taniwha 6y agoI wrote this thread explaining why this stuff is nonsense https://twitter.com/MoonbaseOtago/status/1370922507146985478 https://twitter.com/MoonbaseOtago/status/1370922507146985478
- mxxx 6y agoYeah but that’s exactly what you’d say if you worked for (insert conspiracist bogeyman here)
- NicoJuicy 6y agoAren't nanobots a thing: https://en.m.wikipedia.org/wiki/Nanorobotics https://en.m.wikipedia.org/wiki/Nanorobotics ? Can't the human body be used as an antenna? Just saying, A fool can ask more questions than seven wise men can answer.
- Taniwha 6y agonot really a practical thing (maybe some day, maybe never) - anything can be an antenna, not necessarily a good one, especially if you want some output actual power
- banana_giraffe 5y agoThere's a bigger problem at play here I think, and it's a variant of the CSI Effect. It appears large swaths of people are getting knowledge of the sciences from popular entertainment. Of course they do impossible things all the time in fiction, but too many people seemingly can't distinguish the impossible things from the possible, so we end up with jurors that think "DNA" is the answer to every crime scene question, and people thinking "nanotech" can recreate magic. I'm not sure how to fix this. The long term effects of devaluing knowledge scares me, though.
- kissgyorgy 6y agoSmart people can't really understand dumb people. I'm somewhere in between, so I can see that anybody who actually believes this conspiracy theory would never read something like this, so it does not need to be explained.
- newsbinator 6y agoHow would a vaccine that can connect you to the internet theoretically work? Requirements: * it's a "vaccine" in that it's something introduced into your body to prompt your body to make something else itself * either you can access some information from the internet or you can be accessed in some way from the internet or both * assume the patient has a smartphone with data access
- blackcats 6y ago“There is another reason bad ideas continue to live on, which is that people continue to talk about them. Silence is death for any idea. An idea that is never spoken or written down dies with the person who conceived it. Ideas can only be remembered when they are repeated. They can only be believed when they are repeated.” James Clear
- afiori 6y agoyou might also like https://slatestarcodex.com/2020/05/28/creationism-unchallenged/ https://slatestarcodex.com/2020/05/28/creationism-unchalleng...
- J-dawg 6y agoDoes anyone else have a slight suspicion that this kind of stuff is promoted by authorities as a sort of "nudge"? The goal, I think, is to emphasise the really wacky stuff so that anyone who might have more nuanced concerns about a vaccine (or anything else that differs from the "correct" narrative) gets lumped in with the crazies, and therefore shamed into keeping quiet. The UK government, for example, has openly used psyops tactics on its own population for the duration of the pandemic, so I don't think it's too much of a reach to say that this could be another example of it. > The perceived level of personal threat needs to be increased among those who are complacent, using hard-hitting emotional messaging. From the minutes of SPI-B, the UK government's pandemic psyops group https://evidencenotfear.com/how-sage-and-uk-media-created-fear-in-the-british-public/ https://evidencenotfear.com/how-sage-and-uk-media-created-fe... Compulsory disclaimer that I'm not an anti-vaxxer, I will almost certainly take the vaccine as soon as it's offered to me. I'm just someone who thinks that a government using these fear based tactics on its own people is utterly shameful.
- yodelshady 6y agoYou say that, why not try TCP/IP-over-RNA? GCCAGTGAGTGAGTAAGTATATCCACTTACTTGTGTGTGTGTGTACTCGTC GGCTTGTGGGTGAGTGGGCACGCGGACTCGCATGCTTGCTGACTTGTGTGC AGGTGAGCATGCCAATTTGTGCATTGGCGAGGAGGTGTATGAGTGTATCGG GGTGCGTGGCAGCATGGAGAAAAAAAA
- scoutt 6y agoIf the second dose is a sort or service pack, I hope it will include uBlock.
- pndy 6y agoPolish govt site dedicated to vaccinations has Q&A section with one entry that was removed very fast - it was a question regarding microchips presence within formulas.