7 ms·
My first thought was `wdiff pdizer moderna`. It's short enough to post here in its entirity, but I guess I had better not, anyway it's easy enough to extract fr
by joeyh 6y ago
My first thought was `wdiff pdizer moderna`. It's short enough to post here in its entirity, but I guess I had better not, anyway it's easy enough to extract from the pdf. Add a space after every letter and wdiff can find the common sequences nicely.
Short except for flavor, this is from near the beginning:
A[-G-]AGA{+A+}GAA{+ATATAAGAC+}CCCG{+GCGCCG+}CCACCATGTTCGTGTTCCTGGTGCTGCTGCC[-T-]{+C+}
- koeng 6y agoUs folks in biotech have a special tool just for this :) https://blast.ncbi.nlm.nih.gov/Blast.cgi https://blast.ncbi.nlm.nih.gov/Blast.cgi Unfortunately, the core algorithm dates back to 1990, so it can be real slow in some cases. Biotech takes a while to improve :(
- flobosg 6y agoI think you meant https://www.ebi.ac.uk/Tools/psa/emboss_needle/ https://www.ebi.ac.uk/Tools/psa/emboss_needle/ or https://www.ebi.ac.uk/Tools/psa/emboss_water/ https://www.ebi.ac.uk/Tools/psa/emboss_water/ ;-)
- asdff 6y agoYou can also run blast locally if you need to throw more hardware at it.
- flobosg 6y agoA pairwise sequence alignment done with `needle` starts like this: BioNTech_Pfiz 1 -----------GAGAATAAACTAGTATTCTTCTGGTCCCCACAGACTCAG 39 |||||.|.|..|||| ||| || Moderna 1 GGGAAATAAGAGAGAAAAGAAGAGTA----------------AGA---AG 31 BioNTech_Pfiz 40 AGAGA----AC-------CCGCCACCATGTTCGTGTTCCTGGTGCTGCTG 78 |.|.| || |||||||||||||||||||||||||||||||| Moderna 32 AAATATAAGACCCCGGCGCCGCCACCATGTTCGTGTTCCTGGTGCTGCTG 81 BioNTech_Pfiz 79 CCTCTGGTGTCCAGCCAGTGTGTGAACCTGACCACCAGAACACAGCTGCC 128 ||.||||||..|||||||||.|||||||||||||||.|.||.|||||||| Moderna 82 CCCCTGGTGAGCAGCCAGTGCGTGAACCTGACCACCCGGACCCAGCTGCC 131
- type_enthusiast 6y agoKnowing nothing about biotech – if Moderna and Pfizer were working from the same sequencing data, why would their resulting vaccine mRNA sequences be different? Even slightly? Edit: I guess what I'm asking is: presumably these vaccines both target the spike protein. Do both of these sequences express the same protein? Or is there a "close enough!" thing in the immune system, where it can be a little different and still be targeted by the immune system?
- batterseapower 6y agoThis very cool article explains the mRNA sequence chunk-by-chunk which might give you a flavour of why differences exist: https://berthub.eu/articles/posts/reverse-engineering-source-code-of-the-biontech-pfizer-vaccine/ https://berthub.eu/articles/posts/reverse-engineering-source...
- type_enthusiast 6y agoThat is a super interesting article, thank you for posting it! But, I guess my question is more about why the abstraction of "protein chunks" doesn't fall apart when there are relatively significant "diffs" in the RNA sequence.
- flobosg 6y agoThe most significant diffs between both vaccines occur in the untranslated regions located around the protein coding sequence and will never be present in the actual spike protein. Regarding the protein coding region, because of the degeneracy/redundancy of the genetic code, all changes within it are synonymous and code for identical amino acids.
- Ericson2314 6y ago> Our body runs a powerful antivirus system (“the original one”). Awwww
- zbirkenbuel 6y ago