diffing is not the right approach, it can't detect smaller blocks moving about. since the genome is made out of only A,T,G,C for any change beyond the trivial

diffing is not the right approach, it can't detect smaller blocks moving about. since the genome is made out of only A,T,G,C for any change beyond the trivial diffing may generate the incorrect picture, it lines up the "wrong" bases. Here is a much simpler solution that does a much better job and you don't have to muck around so much. First install some tools: conda install -c bioconda entrez-direct emboss Now do a: # Get the data. efetch -db nuccore -id MG772933 -format fasta > MG772933.fa efetch -db nuccore -id MN988713 -format fasta > MN988713.fa # Align globally. stretcher -filter MG772933.fa MN988713.fa > aligned.txt A much simpler explanation of what is going on (I picked a variable region here): ... MG7729 CACTCCTCACTATTCATAGAGGA-----GAC-CCT----ATGCCTAATAA : : :: :: : :::::: : ::: ::: :: : : : : MN9887 CTTTACTTGCTTTACATAGAAGTTATTTGACTCCTGGTGATTCTTCTTCA ... it also reports: # Length: 29922 # Identity: 26272/29922 (87.8%) # Gaps: 160/29922 ( 0.5%)